OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ENOSF1 (NM_001126123) Human Untagged Clone

Be the first to review this product
SKU
SC323001
ENOSF1 (untagged)-Human enolase superfamily member 1 (ENOSF1), transcript variant 2
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA372480 ENOSF1 rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "ENOSF1 or NM_001126123"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ENOSF1
Synonyms RTS; TYMSAS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC323001 representing NM_001126123.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGAAGATGGAATCAAGGGGTGTGGAATTACCTTCACTCTGGGAAAAGGCACTGAAGTTGATTGGT
CCAGAAAAGGGCGTGGTGCACCTGGCGACAGCGGCCGTCCTAAACGCGGTGTGGGACTTGTGGGCCAAG
CAGGAGGGAAAGCCTGTCTGGAAGTTACTTGTGGACATGGATCCCAGGATGCTGGTATCCTGCATAGAT
TTCAGGTACATCACTGATGTCCTGACTGAGGAGGATGCCCTAGAAATACTGCAGAAAGGTCAAATTGGT
AAAAAAGAAAGAGAGAAGCAAATGCTGGCACAAGGATACCCTGCTTACACGACATCGTGCGCCTGGCTG
GGGTACTCAGATGACACGTTGAAGCAGCTCTGTGCCCAGGCGCTGAAGGATGGCTGGACCAGGTTTAAA
GTAAAGGTGGGTGCTGATCTCCAGGATGACATGCGAAGATGCCAAATCATCCGAGACATGATTGGACCG
GAAAAGACTTTGATGATGGATGCCAACCAGCGCTGGGATGTGCCTGAGGCGGTGGAGTGGATGTCCAAG
CTGGCCAAGTTCAAGCCATTGTGGATTGAGGAGCCAACCTCCCCTGATGACATTCTGGGGCACGCCACC
ATTTCCAAGGCACTGGTCCCATTAGGAATTGGCATTGCCACAGGAGAACAGTGCCACAATAGAGTGATA
TTTAAGCAACTCCTACAGGCGAAGGCCCTGCAGTTCCTCCAGATTGACAGTTGCAGACTGGGCAGTGTC
AATGAGAACCTCTCAGTATTGCTGATGGCCAAAAAGTTTGAAATTCCTGTTTGCCCCCATGCTGGTGGA
GTTGGCCTCTGTGAACTGGTGCAGCACCTGATTATATTTGACTACATATCAGTTTCTGCAAGCCTTGAA
AATAGGGTGTGTGAGTATGTTGACCACCTGCATGAGCATTTCAAGTATCCCGTGATGATCCAGCGGGCT
TCCTACATGCCTCCCAAGGATCCCGGCTACTCAACAGAAATGAAGGAGGAATCTGTAAAGAAACACCAG
TATCCAGATGGTGAAGTTTGGAAGAAACTCCTTCCTGCTCAAGAAAATTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001126123
Insert Size 1086 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001126123.3
RefSeq Size 4206 bp
RefSeq ORF 1086 bp
Locus ID 55556
UniProt ID Q7L5Y1
Cytogenetics 18p11.32
MW 41 kDa
Summary This gene can encode a mitochondrial enzyme that is thought to convert L-fuconate to 2-keto-3-deoxy-L-fuconate. This locus was originally identified as the source of antisense RNAs of the adjacent thymidylate synthase gene. Splice variants at this locus may contain an alternate 3' exon that is complementary to the 3'UTR and terminal intron of the thymidylate synthase (TS) RNA and may downregulate TS expression. provided by RefSeq, Aug 2017
Transcript Variant: This variant (2) uses alternate splicing in the 3' UTR, lacks an exon in the 5' coding region, and uses an alternate frameshifted start codon, compared to variant 1. The encoded isoform (rTSalpha) has a shorter and distinct N-terminus, compared to isoform rTSbeta.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001126123" in other vectors (4)
SKU Description Size Price
RC225544 ENOSF1 (Myc-DDK-tagged)-Human enolase superfamily member 1 (ENOSF1), transcript variant 2 10 ug
$457.00
RC225544L3 Lenti ORF clone of Human enolase superfamily member 1 (ENOSF1), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC225544L4 Lenti ORF clone of Human enolase superfamily member 1 (ENOSF1), transcript variant 2, mGFP tagged 10 ug
$757.00
RG225544 ENOSF1 (tGFP-tagged) - Human enolase superfamily member 1 (ENOSF1), transcript variant 2 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products