OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

EPCAM (NM_002354) Human Untagged Clone

Be the first to review this product
SKU
SC322331
EPCAM (untagged)-Human epithelial cell adhesion molecule (EPCAM)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA506627 EPCAM mouse monoclonal antibody, clone OTI1H9 (formerly 1H9) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "EPCAM or NM_002354"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol EPCAM
Synonyms DIAR5; EGP-2; EGP40; EGP314; ESA; HNPCC8; KS1/4; KSA; M4S1; MIC18; MK-1; TACSTD1; TROP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322331 CCTTCGGCGAGCGAGCACCTTCGACGCGGTCCGGGGACCCCCTCGTCGCTGTCCTCCCGA
CGCGGACCCGCGTGCCCCAGGCCTCGCGCTGCCCGGCCGGCTCCTCGTGTCCCACTCCCG
GCGCACGCCCTCCCGCGAGTCCCGGGCCCCTCCCGCGCCCCTCTTCTCGGCGCGCGCGCA
GCATGGCGCCCCCGCAGGTCCTCGCGTTCGGGCTTCTGCTTGCCGCGGCGACGGCGACTT
TTGCCGCAGCTCAGGAAGAATGTGTCTGTGAAAACTACAAGCTGGCCGTAAACTGCTTTG
TGAATAATAATCGTCAATGCCAGTGTACTTCAGTTGGTGCACAAAATACTGTCATTTGCT
CAAAGCTGGCTGCCAAATGTTTGGTGATGAAGGCAGAAATGAATGGCTCAAAACTTGGGA
GAAGAGCAAAACCTGAAGGGGCCCTCCAGAACAATGATGGGCTTTATGATCCTGACTGCG
ATGAGAGCGGGCTCTTTAAGGCCAAGCAGTGCAACGGCACCTCCACGTGCTGGTGTGTGA
ACACTGCTGGGGTCAGAAGAACAGACAAGGACACTGAAATAACCTGCTCTGAGCGAGTGA
GAACCTACTGGATCATCATTGAACTAAAACACAAAGCAAGAGAAAAACCTTATGATAGTA
AAAGTTTGCGGACTGCACTTCAGAAGGAGATCACAACGCGTTATCAACTGGATCCAAAAT
TTATCACGAGTATTTTGTATGAGAATAATGTTATCACTATTGATCTGGTTCAAAATTCTT
CTCAAAAAACTCAGAATGATGTGGACATAGCTGATGTGGCTTATTATTTTGAAAAAGATG
TTAAAGGTGAATCCTTGTTTCATTCTAAGAAAATGGACCTGACAGTAAATGGGGAACAAC
TGGATCTGGATCCTGGTCAAACTTTAATTTATTATGTTGATGAAAAAGCACCTGAATTCT
CAATGCAGGGTCTAAAAGCTGGTGTTATTGCTGTTATTGTGGTTGTGGTGATAGCAGTTG
TTGCTGGAATTGTTGTGCTGGTTATTTCCAGAAAGAAGAGAATGGCAAAGTATGAGAAGG
CTGAGATAAAGGAGATGGGTGAGATGCATAGGGAACTCAATGCATAACTATATAATTTGA
AGATTATAGAAGAAGGGAAATAGCAAATGGACACAAATTACAAATGTGTGTGCGTGGGAC
GAAGACATCTTTGAAGGTCATGAGTTTGTTAGTTTAACATCATATATTTGTAATAGTGAA
ACCTGTACTCAAAATATAAGCAGCTTGAAACTGGCTTTACCAATCTTGAAATTTGACCAC
AAGTGTCTTATATATGCAGATCTAATGTAAAATCCAGAACTTGGACTCCATCGTTAAAAT
TATTTATGTGTAACATTCAAATGTGTGCATTAAATATGCTTCCACAGTAAAATCTGAAAA
ACTGAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_002354
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002354.1, NP_002345.1
RefSeq Size 1528 bp
RefSeq ORF 945 bp
Locus ID 4072
UniProt ID P16422
Cytogenetics 2p21
Domains thyroglobulin_1
Protein Families ES Cell Differentiation/IPS, Transmembrane
Summary This gene encodes a carcinoma-associated antigen and is a member of a family that includes at least two type I membrane proteins. This antigen is expressed on most normal epithelial cells and gastrointestinal carcinomas and functions as a homotypic calcium-independent cell adhesion molecule. The antigen is being used as a target for immunotherapy treatment of human carcinomas. Mutations in this gene result in congenital tufting enteropathy. provided by RefSeq, Dec 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_002354" in other vectors (7)
SKU Description Size Price
RC201989 EPCAM (Myc-DDK-tagged)-Human epithelial cell adhesion molecule (EPCAM) 10 ug
$300.00
RC201989L1 Lenti ORF clone of Human epithelial cell adhesion molecule (EPCAM), Myc-DDK-tagged 10 ug
$600.00
RC201989L2 Lenti ORF clone of Human epithelial cell adhesion molecule (EPCAM), mGFP tagged 10 ug
$600.00
RC201989L3 Lenti ORF clone of Human epithelial cell adhesion molecule (EPCAM), Myc-DDK-tagged 10 ug
$600.00
RC201989L4 Lenti ORF clone of Human epithelial cell adhesion molecule (EPCAM), mGFP tagged 10 ug
$600.00
RG201989 EPCAM (tGFP-tagged) - Human epithelial cell adhesion molecule (EPCAM) 10 ug
$489.00 $500.00
SC118692 EPCAM (untagged)-Human epithelial cell adhesion molecule (EPCAM) 10 ug
$300.00

file-alt Citations

EpCAM proteolysis and release of complexed claudin-7 repair and maintain the tight junction barrier
Higashi, Saito, Fukazawa et al
J Cell Biol (2023) 222 (1) DOI: 10.1083/jcb.202204079
Cited by 39
AI Summary: OriGene's Mouse anti-EpCAM monoclonal antibody (clone OTI1H9; SC322331) was used in this study to detect EpCAM protein, contributing to the investigation of its role in tight junction repair and maintenance.
Snippet: ito et al., 2021). Thus, the claudin-2-KO cell line is referred to as the “Ctrl” cell line throughout this manuscript. Antibodies Mouse anti-EpCAM mAb (clone OTI1H9;SC322331) was purchased from Origene Technologies. Rabbit anti-EpCAM mAb (clone E6V8Y;#93790) and rabbit anti–α-catenin mAb (clone 23B2;#3240) were purchased from Cell Signaling Technology. Rabbit anti-TMPRSS1 (HPN) polyclon
FigureFigureFigure
Viral and tumor antigen-specific CD8 T-cell responses in Merkel cell carcinoma
Samimi, Benlalam, Aumond et al
Cell. Immunol. (2019) 344, 103961 DOI: 10.1016/j.cellimm.2019.103961
AI Summary: OriGene products contributed EpCAM and Rb pCMV6-XL4 plasmids, which were used to study tumor antigen-specific CD8 T-cell responses in Merkel cell carcinoma.
Snippet: Her-2/neu was a gift from Kostas Kosmatopoulos (UMR484 INSERM, Villejuif, France). EpCAM and Rb pCMV6-XL4 plasmids were purchased from Origene, France. The MCPyV major capsid protein VP1 plasmid was purchased from Addgene, France
Regulation of epithelial migration by epithelial cell adhesion molecule requires its Claudin-7 interaction domain
Barth, Kim, Riedel-Kruse
PLoS ONE (2018) 13 (10), e0204957 DOI: 10.1371/journal.pone.0204957
AI Summary: OriGene’s anti-EpCAM antibody (UMAB131) was used to assess EpCAM protein levels by immunoblotting in MDCK cell lines with altered EpCAM expression, enabling the study of EpCAM’s role in regulating epithelial migration.
Snippet: SH134T-mU6-01). Stable MDCK cell lines either overexpressing EpCAM or depleted of EpCAM were established by screening clonal lines for EpCAM levels by immunoblotting with anti-EpCAM antibody UMAB131 (OriGene Technologies, Inc., Rockville, MD). EpCAM-depleted MDCK line Esh2 was transfected with expression vectors for EY (EpCAM-YFP), EIY (EpCAM-YFP defective for Claudin-7 binding), or EEY (EpCAM-YFP
FigureFigureFigure
WB
Off-target-free gene delivery by affinity-purified receptor-targeted viral vectors
Münch, Muth, Muik et al
Nat Commun (2015) 6, 6246 DOI: 10.1038/ncomms7246
Cited by 140
AI Summary: OriGene's pCMV6-AC-EpCAMcDNA plasmid was used as the source of human EpCAM cDNA to generate CHO-EpCAM cells for evaluating the specificity of receptor-targeted AAV vectors in this study.
Snippet: A3.01 (ATCC CRL-2570), A2.01 (ATCC CCL-120.1), Raji (ATCC CCL-86) and Jurkat (ATCC TIB-152) cells were grown in RPMI medium supplemented with 10% FCS and 1% glutamine. For the generation of CHO-EpCAM cells, the cDNA sequence of human EpCAM (pCMV6-AC-EpCAMcDNA, Origene, Rockville, USA) and a puromycin resistance gene were cloned into a lentiviral transfer vector resulting in the bicistronic plasmid...
Epithelial cell adhesion molecule (EpCAM) is associated with prostate cancer metastasis and chemo/radioresistance via the PI3K/Akt/mTOR signaling pathway
Ni, Cozzi, Hao et al
Int. J. Biochem. Cell Biol. (2013) 45 (12), 2736-2748 DOI: 10.1016/j.biocel.2013.09.008
Cited by 203
AI Summary: OriGene’s EpCAM expression plasmid and empty vector were used to manipulate EpCAM levels in prostate cancer cells, enabling the study of EpCAM’s role in cancer metastasis and treatment resistance.
Snippet: EpCAM expression plasmid and empty vector were purchased from OriGene Technologies Inc (Rockville, MD, USA). Insulin, B27, EGF, bFGF and G418 were purchased from Invitrogen Australia Pty Ltd (Melbourne, VIC, Australia). Table 1.
Ep-CAM is a significant prognostic factor in pancreatic cancer patients by suppressing cell activity
Akita, Nagano, Takeda et al
Oncogene (2011) 30 (31), 3468-76 DOI: 10.1038/onc.2011.59
Cited by 43
AI Summary: OriGene contributed to this study by providing the Ep-CAM expression plasmid, which was used to generate Ep-CAM-transfected pancreatic cancer cell lines for functional assays investigating the role of Ep-CAM in cell activity and prognosis.
Snippet: These factors leads to the selection of patients who actually need to receive the intensive post-operative therapy based on significant parameters. ... Gene transfection. Ep-CAM expression plasmid was purchased from OriGene Technologies Inc. (Rockville, MD, USA).
Showing 1-6 of 6 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products