OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

RAB5C (NM_201434) Human Untagged Clone

Be the first to review this product
SKU
SC322014
RAB5C (untagged)-Human RAB5C, member RAS oncogene family (RAB5C), transcript variant 1
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "RAB5C or NM_201434"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RAB5C
Synonyms L1880; RAB5CL; RAB5L; RABL
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322014 AGCGGCTGAAAGGCGGAAGTGGAGGCCGGAGCCTGGGACACCGCCGGCGGGGAGAGAAGC
GGATCCCGTCCGAGCCCCGGCCCCAAGTAACGCCGCCGCCCCGGAGCCGCCTTGGAGGTC
CCCCTCCCCACTAAGTGCCTCTTTGCATAGCACCAGTCCCCACCCGCACGCTCTCTGGAC
CACTACAGCTGGACGGGCAATGGCGGGTCGGGGAGGCGCAGCACGACCCAATGGACCAGC
TGCTGGGAACAAGATCTGTCAATTTAAGCTGGTTCTGCTGGGGGAGTCTGCGGTAGGCAA
ATCCAGCCTCGTCCTCCGCTTTGTCAAGGGACAGTTTCACGAGTACCAGGAGAGCACAAT
TGGAGCGGCCTTCCTCACACAGACTGTCTGCCTGGATGACACAACAGTCAAGTTTGAGAT
CTGGGACACAGCTGGACAGGAGCGGTATCACAGCCTGGCCCCCATGTACTATCGGGGGGC
CCAGGCTGCCATCGTGGTCTATGACATCACCAACACAGATACATTTGCACGGGCCAAGAA
CTGGGTGAAGGAGCTACAGAGGCAGGCCAGCCCCAACATCGTCATTGCACTCGCGGGTAA
CAAGGCAGACCTGGCCAGCAAGAGAGCCGTGGAATTCCAGGAAGCACAAGCCTATGCAGA
CGACAACAGTTTGCTGTTCATGGAGACATCAGCAAAGACTGCAATGAACGTGAACGAAAT
CTTCATGGCAATAGCTAAGAAGCTTCCCAAGAACGAGCCCCAGAATGCAACTGGTGCTCC
AGGCCGAAACCGAGGTGTGGACCTCCAGGAGAACAACCCAGCCAGCCGGAGCCAGTGCTG
CAGCAACTGAGCCCCCCTTGCCTGCCCGCTGCCCCCGCCTCCTCCGCCTGAATGACCCGA
CTGGAATCCACTCTAACCAATCGCACTTAACGACTCGGGCCACCACTGGGGGGGCAGGGG
GAGGGGTCCACCATGATTTCTCCATATAATTTTGATCATAGGCCGGAGTGAGTCATTCCA
CCTGCACCTTTCTGTACAAATACTAATTCAATTTTAAGTCTTAAGTCACTTTTTTAATAT
ATATGATCTTCTGCTCTTCCCACTTCCTCCCCTTTCTACTGCTCTCCCATTTTCCCTTGC
TGGGAGTAGCCACATGCTCTTGCCCCCCAACCCTTGTATATGGGGACAGTGGGGTCAGTG
CAGCTACCCTTTCTTTCCCTCCTGCGGAACAGCGGACCCAGCAAGAGCATCCACATCCTC
ACTTTGTTCGGAGTGGTCTTTGGTTTGGGCGGTGGGGCAGACCTTGGGAAGGGGCTTAGG
AAGGGAGAGGCAGCTCTTCCTTCAGCTGGCTCTCATCAGGCTGCAGCCCCCTCCCCGCTC
CCACCTCCCTGCTGGGAAACCACAGCATTATCACAGCATTATTGTGACAGCCACGAACCC
ATTGCCCACAACCCCTCCACCCTCGGTCACCCCAACCTCTGGCTCTGAGCCCTGTTCTGA
CCAAATCATGATGATGAGTATTTGGGGGTGGGTGGGTAAGGGGGGGAGTGGGAGGGGACG
GAACCAACTTTTTCTGTATTTTGTATTGTATGTTTTCTTCAACATGTAACCAATCAGTAT
CTTGTCAATATAGTCAGCCGATCGATCGACCTCAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_201434
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_201434.1, NP_958842.1
RefSeq Size 1791 bp
RefSeq ORF 651 bp
Locus ID 5878
UniProt ID P51148
Cytogenetics 17q21.2
Protein Families Druggable Genome
Protein Pathways Endocytosis
Summary Members of the Rab protein family are small GTPases of the Ras superfamily that are thought to ensure fidelity in the process of docking and/or fusion of vesicles with their correct acceptor compartment (Han et al., 1996 PubMed 8646882).supplied by OMIM, Nov 2010
Transcript Variant: This variant (1) encodes isoform a. Variants 1 and 2 encode the same isoform.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_201434" in other vectors (6)
SKU Description Size Price
RC210698 RAB5C (Myc-DDK-tagged)-Human RAB5C, member RAS oncogene family (RAB5C), transcript variant 1 10 ug
$300.00
RC210698L1 Lenti ORF clone of Human RAB5C, member RAS oncogene family (RAB5C), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC210698L2 Lenti ORF clone of Human RAB5C, member RAS oncogene family (RAB5C), transcript variant 1, mGFP tagged 10 ug
$600.00
RC210698L3 Lenti ORF clone of Human RAB5C, member RAS oncogene family (RAB5C), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC210698L4 Lenti ORF clone of Human RAB5C, member RAS oncogene family (RAB5C), transcript variant 1, mGFP tagged 10 ug
$600.00
RG210698 RAB5C (tGFP-tagged) - Human RAB5C, member RAS oncogene family (RAB5C), transcript variant 1 10 ug
$489.00 $500.00

file-alt Citations

RAB5C Increases Endothelial Release of VWF by Regulating Vesicle Trafficking
Reventun, Toledano-Sanz, Delgado-Marin et al
Arterioscler Thromb Vasc Biol (2026) 46 (3), e323000 DOI: 10.1161/ATVBAHA.125.323000
AI Summary: In this study, the OriGene RAB5C Wild-type (WT) construct (SC322014) was used to overexpress RAB5C in endothelial cells, enabling the researchers to investigate its role in regulating VWF release and vesicle trafficking.
Snippet: lization with cold PBS. Cells were lysed and Western blot was performed, and membranes were probed with anti-GST and for GAPDH. RAB5C CONSTRUCTS The RAB5C Wild-type (WT) construct was obtained from Origene (SC322014). The V5-TurboID-NES_pCDNA3 was a gift from Alice Ting50 (Addgene plasmid # 107169;http://n2t.net/addgene:107169;RRID:Addgene_107169). The fusion constructs were generated using I
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products