OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

RAD51C (NM_058216) Human Untagged Clone

Be the first to review this product
SKU
SC321013
RAD51C (untagged)-Human RAD51 homolog C (S. cerevisiae) (RAD51C), transcript variant 1
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "RAD51C or NM_058216"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RAD51C
Synonyms BROVCA3; FANCO; R51H3; RAD51L2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_058216.1 GGGGGACGTCACGCCGCACGCCCCAGCGAGGGCGTGCGGAGTTTGGCTGCTCCGGGGTTA
GCAGGTGAGCCTGCGATGCGCGGGAAGACGTTCCGCTTTGAAATGCAGCGGGATTTGGTG
AGTTTCCCGCTGTCTCCAGCGGTGCGGGTGAAGCTGGTGTCTGCGGGGTTCCAGACTGCT
GAGGAACTCCTAGAGGTGAAACCCTCCGAGCTTAGCAAAGAAGTTGGGATATCTAAAGCA
GAAGCCTTAGAAACTCTGCAAATTATCAGAAGAGAATGTCTCACAAATAAACCAAGATAT
GCTGGTACATCTGAGTCACACAAGAAGTGTACAGCACTGGAACTTCTTGAGCAGGAGCAT
ACCCAGGGCTTCATAATCACCTTCTGTTCAGCACTAGATGATATTCTTGGGGGTGGAGTG
CCCTTAATGAAAACAACAGAAATTTGTGGTGCACCAGGTGTTGGAAAAACACAATTATGT
ATGCAGTTGGCAGTAGATGTGCAGATACCAGAATGTTTTGGAGGAGTGGCAGGTGAAGCA
GTTTTTATTGATACAGAGGGAAGTTTTATGGTTGATAGAGTGGTAGACCTTGCTACTGCC
TGCATTCAGCACCTTCAGCTTATAGCAGAAAAACACAAGGGAGAGGAACACCGAAAAGCT
TTGGAGGATTTCACTCTTGATAATATTCTTTCTCATATTTATTATTTTCGCTGTCGTGAC
TACACAGAGTTACTGGCACAAGTTTATCTTCTTCCAGATTTCCTTTCAGAACACTCAAAG
GTTCGACTAGTGATAGTGGATGGTATTGCTTTTCCATTTCGTCATGACCTAGATGACCTG
TCTCTTCGTACTCGGTTATTAAATGGCCTAGCCCAGCAAATGATCAGCCTTGCAAATAAT
CACAGATTAGCTGTAATTTTAACCAATCAGATGACAACAAAGATTGATAGAAATCAGGCC
TTGCTTGTTCCTGCATTAGGGGAAAGTTGGGGACATGCTGCTACAATACGGCTAATCTTT
CATTGGGACCGAAAGCAAAGGTTGGCAACATTGTACAAGTCACCCAGCCAGAAGGAATGC
ACAGTACTGTTTCAAATCAAACCTCAGGGATTTAGAGATACTGTTGTTACTTCTGCATGT
TCATTGCAAACAGAAGGTTCCTTGAGCACCCGGAAACGGTCACGAGACCCAGAGGAAGAA
TTATAACCCAGAAACAAATCTCAAAGTGTACAAATTTATTGATGTTGTGAAATCAATGTG
TACAAGTGGACTTGTTACCTTAAAGTATAAATAAACACACTATGGCACGAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_058216
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_058216.1, NP_478123.1
RefSeq Size 1295 bp
RefSeq ORF 1131 bp
Locus ID 5889
UniProt ID O43502
Cytogenetics 17q22
Protein Families Druggable Genome
Protein Pathways Homologous recombination
Summary This gene is a member of the RAD51 family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51 and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with other RAD51 paralogs and is reported to be important for Holliday junction resolution. Mutations in this gene are associated with Fanconi anemia-like syndrome. This gene is one of four localized to a region of chromosome 17q23 where amplification occurs frequently in breast tumors. Overexpression of the four genes during amplification has been observed and suggests a possible role in tumor progression. Alternative splicing results in multiple transcript variants. provided by RefSeq, Jul 2013
Transcript Variant: This variant (1) is the longest transcript and encodes the longer isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_058216" in other vectors (7)
SKU Description Size Price
RC210462 RAD51C (Myc-DDK-tagged)-Human RAD51 homolog C (S. cerevisiae) (RAD51C), transcript variant 1 10 ug
$686.00
RC210462L1 Lenti ORF clone of Human RAD51 homolog C (S. cerevisiae) (RAD51C), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC210462L2 Lenti ORF clone of Human RAD51 homolog C (S. cerevisiae) (RAD51C), transcript variant 1, mGFP tagged 10 ug
$986.00
RC210462L3 Lenti ORF clone of Human RAD51 homolog C (S. cerevisiae) (RAD51C), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC210462L4 Lenti ORF clone of Human RAD51 homolog C (S. cerevisiae) (RAD51C), transcript variant 1, mGFP tagged 10 ug
$986.00
RG210462 RAD51C (tGFP-tagged) - Human RAD51 homolog C (S. cerevisiae) (RAD51C), transcript variant 1 10 ug
$886.00
SC109703 RAD51C (untagged)-Human RAD51 homolog C (S. cerevisiae) (RAD51C), transcript variant 1 10 ug
$457.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products