OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

COMT (NM_007310) Human Untagged Clone

Be the first to review this product
SKU
SC320911
COMT (untagged)-Human catechol-O-methyltransferase (COMT), transcript variant 4
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA365674 COMT rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "COMT or NM_007310"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol COMT
Synonyms HEL-S-98n
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_007310.1 GAAATAACATCTGCTTTGCTGCCGAGCTCAGAGGAGACCCCAGACCCCTCCCGCAGCCAG
AGGGCTGGAGCCTGCTCAGAGGTGCTTTGAAGATGCCGGAGGCCCCGCCTCTGCTGTTGG
CAGCTGTGTTGCTGGGCCTGGTGCTGCTGGTGGTGCTGCTGCTGCTTCTGAGGCACTGGG
GCTGGGGCCTGTGCCTTATCGGCTGGAACGAGTTCATCCTGCAGCCCATCCACAACCTGC
TCATGGGTGACACCAAGGAGCAGCGCATCCTGAACCACGTGCTGCAGCATGCGGAGCCCG
GGAACGCACAGAGCGTGCTGGAGGCCATTGACACCTACTGCGAGCAGAAGGAGTGGGCCA
TGAACGTGGGCGACAAGAAAGGCAAGATCGTGGACGCCGTGATTCAGGAGCACCAGCCCT
CCGTGCTGCTGGAGCTGGGGGCCTACTGTGGCTACTCAGCTGTGCGCATGGCCCGCCTGC
TGTCACCAGGGGCGAGGCTGATCACCATCGAGATCAACCCCGACTGTGCCGCCATCACCC
AGCGGATGGTGGATTTCGCTGGCGTGAAGGACAAGGTCACCCTTGTGGTTGGAGCGTCCC
AGGACATCATCCCCCAGCTGAAGAAGAAGTATGATGTGGACACACTGGACATGGTCTTCC
TCGACCACTGGAAGGACCGGTACCTGCCGGACACGCTTCTCTTGGAGGAATGTGGCCTGC
TGCGGAAGGGGACAGTGCTACTGGCTGACAACGTGATCTGCCCAGGTGCGCCAGACTTCC
TAGCACACGTGCGCGGGAGCAGCTGCTTTGAGTGCACACACTACCAATCGTTCCTGGAAT
ACAGGGAGGTGGTGGACGGCCTGGAGAAGGCCATCTACAAGGGCCCAGGCAGCGAAGCAG
GGCCCTGACTGCCCCCCCCGGCCCCCCTCTCGGGCTCTCTCACCCAGCCTGGTACTGAAG
GTGCCAGACGTGCTCCTGCTGACCTTCTGCGGCTCCGGGCTGTGTCCTAAATGCAAAGCA
CACCTCGGCCGAGGCCTGCGCCCTGACATGCTAACCTCTCTGAACTGCAACACTGGATTG
TTCTTTTTTAAGACTCAATCATGACTTCTTTACTAACACTGGCTAGCTATATTATCTTAT
ATACTAATATCATGTTTTAAAAATATAAAATAGAAATTAAGAATCTAAATATTTAGATAA
AAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_007310
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_007310.1, NP_009294.1
RefSeq Size 1067 bp
RefSeq ORF 666 bp
Locus ID 1312
UniProt ID P21964
Cytogenetics 22q11.21
Protein Families Druggable Genome, Transmembrane
Protein Pathways Metabolic pathways, Tyrosine metabolism
Summary Catechol-O-methyltransferase catalyzes the transfer of a methyl group from S-adenosylmethionine to catecholamines, including the neurotransmitters dopamine, epinephrine, and norepinephrine. This O-methylation results in one of the major degradative pathways of the catecholamine transmitters. In addition to its role in the metabolism of endogenous substances, COMT is important in the metabolism of catechol drugs used in the treatment of hypertension, asthma, and Parkinson disease. COMT is found in two forms in tissues, a soluble form (S-COMT) and a membrane-bound form (MB-COMT). The differences between S-COMT and MB-COMT reside within the N-termini. Several transcript variants are formed through the use of alternative translation initiation sites and promoters. provided by RefSeq, Sep 2008
Transcript Variant: This variant (4, also known as S-COMT) contains a shorter 5' UTR and a translation start site which lies 50 codons downstream compared to that of variant 1. The resulting isoform (S-COMT) is shorter at the N-terminus compared to isoform MB-COMT. S-COMT is a soluble protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_007310" in other vectors (5)
SKU Description Size Price
RC204127 COMT (Myc-DDK-tagged)-Human catechol-O-methyltransferase (COMT), transcript variant 4 10 ug
$289.00 $300.00
RC204127L3 Lenti-ORF clone of COMT (Myc-DDK-tagged)-Human catechol-O-methyltransferase (COMT), transcript variant 4 10 ug
$600.00
RC204127L4 Lenti-ORF clone of COMT (mGFP-tagged)-Human catechol-O-methyltransferase (COMT), transcript variant 4 10 ug
$600.00
RG204127 COMT (tGFP-tagged) - Human catechol-O-methyltransferase (COMT), transcript variant 4 10 ug
$489.00 $500.00
SC109094 COMT (untagged)-Human catechol-O-methyltransferase (COMT), transcript variant 4 10 ug
$300.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products