OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

RABL4 (IFT27) (NM_006860) Human Untagged Clone

Be the first to review this product
SKU
SC320196
IFT27 (untagged)-Human intraflagellar transport 27 homolog (Chlamydomonas) (IFT27), transcript variant 2
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA370497 IFT27 rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "RABL4 or NM_006860"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RABL4
Synonyms BBS19; FAP156; RABL4; RAYL
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_006860.2 GCTATGGTTGCTTGGAGAGTGCATCCGGCCCGGTACTTGTGATCGGAGGAGAGCCGGATC
GTCCTTCCTTGAACCCTCTGGGTAGGGCTGTGCTGAGGGGCTGGGCGGGGAGCACAGGCC
GTGTCCGCTCGCTTGCACCTTTTCAGACTGCCGTGTCAGGCCTCGAGCCGGGCCCACCTG
GAGCCCTCCCCTGCCCACCCGCCCCCAGCGCTCGATATCCGCCCCCGGCCCAGAAGGGCC
GGGCTCGGTCATCCCCAGTCCCGTCGCGGCCACTGACCCTTGAGATCAGCCCTCCCCTCC
CCACCTTCCCGTCCCAGGCCAGCCCAGGGCCCGAAGCCCACCCACTCGCGTCTCTAGCAG
CCGCTCTTGTCCTCTGGGTACGGCTCGCGGGAGTGTTGGTTACCATGGTGAAGCTGGCAG
CCAAATGCATCCTGGCAGGAGACCCAGCAGTGGGCAAGACCGCCCTGGCACAGATCTTCC
GCAGTGATGGAGCCCATTTCCAGAAAAGCTACACCCTGACAACAGGAATGGATTTGGTGG
TGAAGACAGTGCCAGTTCCTGACACGGGAGACAGTGTGGAACTCTTCATTTTTGACTCTG
CTGGCAAGGAGCTGTTTTCGGAAATGCTGGATAAATTGTGGGAGAGTCCCAATGTCTTAT
GTCTCGTCTATGATGTGACCAATGAAGAATCCTTCAACAACTGCAGCAAGTGGCTGGAGA
AGGCTCGGTCACAGGCTCCAGGCATCTCTCTCCCAGGTGTTTTAGTTGGGAACAAGACAG
ACCTGGCCGGCAGACGAGCAGTGGACTCAGCTGAGGCCCGGGCATGGGCGCTGGGCCAGG
GCCTGGAATGTTTTGAAACATCCGTGAAAGAGATGGAAAACTTCGAAGCCCCTTTCCACT
GCCTTGCCAAGCAGTTCCACCAGCTGTACCGGGAGAAGGTGGAGGTTTTCCGGGCCCTGG
CATGACGAGCTGGAGCAGATCGTGCTGCACAACCGGAGAAGACAGAATTACCTCTGCTCT
TTTAATATATAATGATGGCTTTAAATAAAATTAGGAGAAAATGTCAAAAAAAAAAAAAAA
AAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_006860
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006860.2, NP_006851.1
RefSeq Size 1021 bp
RefSeq ORF 558 bp
Locus ID 11020
UniProt ID Q9BW83
Cytogenetics 22q12.3
Domains RAB, ras, RAS, RHO
Protein Families Druggable Genome
Summary This gene encodes a GTP-binding protein that is a core component of the intraflagellar transport complex B. Characterization of the similar Chlamydomonas protein indicates a function in cell cycle control. Alternative splicing of this gene results in multiple transcript variants. provided by RefSeq, Jan 2012
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1, resulting in an isoform (2) that is 1 aa shorter than isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_006860" in other vectors (4)
SKU Description Size Price
RC200215 IFT27 (Myc-DDK-tagged)-Human intraflagellar transport 27 homolog (Chlamydomonas) (IFT27), transcript variant 2 10 ug
$300.00
RC200215L3 Lenti ORF clone of Human intraflagellar transport 27 homolog (Chlamydomonas) (IFT27), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC200215L4 Lenti ORF clone of Human intraflagellar transport 27 homolog (Chlamydomonas) (IFT27), transcript variant 2, mGFP tagged 10 ug
$600.00
RG200215 IFT27 (tGFP-tagged) - Human intraflagellar transport 27 homolog (Chlamydomonas) (IFT27), transcript variant 2 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products