OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Apolipoprotein E (APOE) (NM_000041) Human Untagged Clone

Be the first to review this product
SKU
SC319433
APOE (untagged)-Human apolipoprotein E (APOE)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA309573 Mouse Monoclonal ApoE4 Antibody (4E4)
100 ul
$620.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Apolipoprotein E or NM_000041"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Apolipoprotein E
Synonyms AD2; APO-E; ApoE4; LDLCQ5; LPG
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000041.2 GGACGTCCTTCCCCAGGAGCCGACTGGCCAATCACAGGCAGGAAGATGAAGGTTCTGTGG
GCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAG
ACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAA
CTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTG
CAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACC
ATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAG
GAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGAC
ATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGC
CAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGG
CTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGC
GAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAG
GGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCC
CAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGAC
CGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCC
CAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCC
CTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTG
GGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTGAACGCCGAAGCCTGCAGCCATG
CGACCCCACGCCACCCCGTGCCTCCTGCCTCCGCGCAGCCTGCAGCGGGAGACCCTGTCC
CCGCCCCAGCCGTCCTCCTGGGGTGGACCCTAGTTTAATAAAGATTCACCAAGTTTCACG
CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAC
Restriction Sites Please inquire |
ACCN NM_000041
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000041.2, NP_000032.1
RefSeq Size 1223 bp
RefSeq ORF 954 bp
Locus ID 348
UniProt ID P02649
Cytogenetics 19q13.32
Domains Apolipoprotein
Protein Families Adult stem cells, Druggable Genome, Secreted Protein, Stem cell - Pluripotency
Protein Pathways Alzheimer's disease
Summary The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. provided by RefSeq, Jun 2016
Transcript Variant: This variant (2) contains an alternate 5' terminal exon, and it thus differs in the 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a. Variants 2, 3, 4 and 5 all encode isoform b.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_000041" in other vectors (6)
SKU Description Size Price
RC200395 APOE (Myc-DDK-tagged)-Human apolipoprotein E (APOE) 10 ug
$300.00
RC200395L1 Lenti ORF clone of Human apolipoprotein E (APOE), Myc-DDK-tagged 10 ug
$600.00
RC200395L2 Lenti ORF clone of Human apolipoprotein E (APOE), mGFP tagged 10 ug
$600.00
RC200395L3 Lenti ORF clone of Human apolipoprotein E (APOE), Myc-DDK-tagged 10 ug
$600.00
RC200395L4 Lenti ORF clone of Human apolipoprotein E (APOE), mGFP tagged 10 ug
$600.00
RG200395 APOE (tGFP-tagged) - Human apolipoprotein E (APOE) 10 ug
$489.00 $500.00

file-alt Citations

The mitochondrial BCKD complex interacts with hepatic apolipoprotein E in cultured cells in vitro and mouse livers in vivo
Rueter, Rimbach, Treitz et al
Cell Mol Life Sci (2023) 80 (3), 59 DOI: 10.1007/s00018-023-04706-x
Cited by 5
AI Summary: OriGene's human APOE3-expressing pCMV6-AC vector (SC319433) was used to generate APOE3 and APOE4 expression constructs for transfecting cultured cells, enabling the study of genotype-specific effects of APOE protein interactions in this research.
Snippet: mids containing human APOE3 and APOE4 DNA were used to study genotype-specific effects of the APOE protein in cultured cells. The human APOE3 (NM_000041)-expressing pCMV6-AC vector was purchased from OriGene (SC319433, Rockville, USA). The APOE4 vector was constructed by custom mutagenesis of SC319433 by a T-to-C substitution at nucleotide position 388, resulting in an amino acid alteration of cys
FigureFigureFigure
Influence of the APOE genotype on hepatic stress response: Studies in APOE targeted replacement mice and human liver cells
Dose, Nebel, Piegholdt et al
Free Radic. Biol. Med. (2016)
Cited by 12
AI Summary: OriGene products, specifically the human APOE3 and APOE4 expression plasmids and the pCMV6-AC mock vector, were used to overexpress APOE isoforms and provide negative controls in HuH7 cell experiments investigating the effects of APOE genotype on hepatic stress responses.
Snippet: Plasmids for introduction of human APOE3 and APOE4 into HuH7 cells were purchased from OriGene (Rockville, USA). ... The mock vector pCMV6-AC (OriGene, Rockville, USA) served as a negative control in all experiments. ... Cite SaveSaving
The C-terminal alpha-helix domain of apolipoprotein E is required for interaction with nonstructural protein 5A and assembly of hepatitis C virus
Cun, Jiang, Luo
J Virol (2010) 84 (21), 11532-41 DOI: 10.1128/JVI.01021-10
AI Summary: OriGene products, specifically the human apolipoprotein E (apoE) expression plasmids (OriGene Cat# RC204204, RC204205, RC204206), were used to investigate the role of different apoE isoforms in their interaction with HCV NS5A and the assembly of infectious hepatitis C virus.
Human apolipoprotein e is required for infectivity and production of hepatitis C virus in cell culture
Chang, Jiang, Cai et al
J Virol (2007) 81 (24), 13783-93 DOI: 10.1128/JVI.01091-07
AI Summary: In this study, OriGene’s apoE-specific siRNA was used to knock down apoE expression, demonstrating that apoE is essential for hepatitis C virus infectivity and production in cell culture.
FigureFigureFigure
Showing 1-4 of 4 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products