OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

COPE (NM_007263) Human Untagged Clone

Be the first to review this product
SKU
SC319189
COPE (untagged)-Human coatomer protein complex, subunit epsilon (COPE), transcript variant 1
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA324398 COPE Antibody (C-term)
400 ul
$645.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "COPE or NM_007263"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol COPE
Synonyms epsilon-COP
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_007263.3 CTGGTGAGAAGACAGCGAAATGGCGCCTCCGGCCCCCGGCCCGGCCTCCGGCGGCTCCGG
GGAGGTAGACGAGCTGTTCGACGTAAAGAACGCCTTCTACATCGGCAGCTACCAGCAGTG
CATAAACGAGGCGCAGCGGGTGAAGCTGTCAAGCCCAGAGAGAGACGTGGAGAGGGACGT
CTTCCTGTATAGAGCGTACCTGGCGCAGAGGAAGTTCGGTGTGGTCCTGGATGAGATCAA
GCCCTCCTCGGCCCCTGAGCTCCAGGCCGTGCGCATGTTTGCTGACTACCTCGCCCACGA
GAGTCGGAGGGACAGCATCGTGGCCGAGCTGGACCGAGAGATGAGCAGGAGCGTGGACGT
GACCAACACCACCTTCCTGCTCATGGCCGCCTCCATCTATCTCCACGACCAGAACCCGGA
TGCCGCCCTGCGTGCGCTGCACCAGGGGGACAGCCTGGAGTGCACAGCCATGACAGTGCA
GATCCTGCTGAAGCTGGACCGCCTGGACCTCGCCCGGAAGGAGCTGAAGAGAATGCAGGA
CCTGGACGAGGATGCCACCCTCACCCAGCTCGCCACTGCCTGGGTCAGCCTGGCCACGGG
TGGTGAGAAGCTGCAGGATGCCTACTACATCTTCCAGGAGATGGCTGACAAGTGCTCGCC
CACCCTGCTGCTGCTCAATGGGCAGGCGGCCTGCCACATGGCCCAGGGCCGCTGGGAGGC
CGCTGAGGGCCTGCTGCAGGAGGCGCTAGACAAGGATAGTGGCTACCCGGAGACGCTGGT
CAACCTCATCGTCCTGTCCCAGCACCTGGGCAAGCCCCCTGAGGTGACAAACCGATACCT
GTCCCAGCTGAAGGATGCCCACAGGTCCCATCCCTTCATCAAGGAGTACCAGGCCAAGGA
GAACGACTTTGACAGGCTGGTGCTACAGTACGCTCCCAGCGCCTGAGGCTGGCCCAGAGC
TGTCAGGACCATGAAGCCAGGACAGAGGCCAGGAGCCAGCCCTGCAGCCCTCCCCACCCG
GCATCCACCTGCATCCCCTCTGGGGGCAGGAGCCCACCCCCAGCACCCCCATCTGTTAAT
AAATATCTCAACTCCAGGGTGTTCCACCTGAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_007263
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_007263.3, NP_009194.2
RefSeq Size 1134 bp
RefSeq ORF 927 bp
Locus ID 11316
UniProt ID O14579
Cytogenetics 19p13.11
Domains Coatomer_E
Summary The product of this gene is an epsilon subunit of coatomer protein complex. Coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles. It is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. Coatomer complex consists of at least the alpha, beta, beta', gamma, delta, epsilon and zeta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. provided by RefSeq, Jul 2008
Transcript Variant: This variant (1) encodes isoform a.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_007263" in other vectors (4)
SKU Description Size Price
RC203531 COPE (Myc-DDK-tagged)-Human coatomer protein complex, subunit epsilon (COPE), transcript variant 1 10 ug
$300.00
RC203531L3 Lenti ORF clone of Human coatomer protein complex, subunit epsilon (COPE), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC203531L4 Lenti ORF clone of Human coatomer protein complex, subunit epsilon (COPE), transcript variant 1, mGFP tagged 10 ug
$600.00
RG203531 COPE (tGFP-tagged) - Human coatomer protein complex, subunit epsilon (COPE), transcript variant 1 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products