OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

EGLN2 (NM_080732) Human Untagged Clone

Be the first to review this product
SKU
SC317651
EGLN2 (untagged)-Human egl nine homolog 2 (C. elegans) (EGLN2), transcript variant 3
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA808584 EGLN2 mouse monoclonal antibody, clone OTI7H3 (formerly 7H3) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "EGLN2 or NM_080732"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol EGLN2
Synonyms EIT-6; EIT6; HIF-PH1; HIFPH1; HPH-1; HPH-3; PHD1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317651 representing NM_080732.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACAGCCCGTGCCAGCCGCAGCCCCTAAGTCAGGCTCTCCCTCAGTTACCAGGGTCTTCGTCAGAG
CCCTTGGAGCCTGAGCCTGGCCGGGCCAGGATGGGAGTGGAGAGTTACCTGCCCTGTCCCCTGCTCCCC
TCCTACCACTGTCCAGGAGTGCCTAGTGAGGCCTCGGCAGGGAGTGGGACCCCCAGAGCCACAGCCACC
TCTACCACTGCCAGCCCTCTTCGGGACGGTTTTGGCGGGCAGGATGGTGGTGAGCTGCGGCCGCTGCAG
AGTGAAGGCGCTGCAGCGCTGGTCACCAAGGGGTGCCAGCGATTGGCAGCCCAGGGCGCACGGCCTGAG
GCCCCCAAACGGAAATGGGCCGAGGATGGTGGGGATGCCCCTTCACCCAGCAAACGGCCCTGGGCCAGG
CAAGAGAACCAGGAGGCAGAGCGGGAGGGTGGCATGAGCTGCAGCTGCAGCAGTGGCAGTGGTGAGGCC
AGTGCTGGGCTGATGGAGGAGGCGCTGCCCTCTGCGCCCGAGCGCCTGGCCCTGGACTATATCGTGCCC
TGCATGCGGTACTACGGCATCTGCGTCAAGGACAGCTTCCTGGGGGCAGCACTGGGCGGTCGCGTGCTG
GCCGAGGTGGAGGCCCTCAAACGGGGTGGGCGCCTGCGAGACGGGCAGCTAGTGAGCCAGAGGGCGATC
CCGCCGCGCAGCATCCGTGGGGACCAGATTGCCTGGGTGGAAGGCCATGAACCAGGCTGTCGAAGCATT
GGTGCCCTCATGGCCCATGTGGACGCCGTCATCCGCCACTGCGCAGGGCGGCTGGGCAGCTATGTCATC
AACGGGCGCACCAAGGCCATGGTGGCGTGTTACCCAGGCAACGGGCTCGGGTACGTAAGGCACGTTGAC
AATCCCCACGGCGATGGGCGCTGCATCACCTGTATCTATTACCTGAATCAGAACTGGGACGTTAAGGTG
CATGGCGGCCTGCTGCAGATCTTCCCTGAGGGCCGGCCCGTGGTAGCCAACATCGAGCCACTCTTTGAC
CGGTTGCTCATTTTCTGGTCTGACCGGCGGAACCCCCACGAGGTGAAGCCAGCCTATGCCACCAGGTAC
GCCATCACTGTCTGGTATTTTGATGCCAAGGAGCGGGCAGCAGCCAAAGACAAGTATCAGCTAGCATCA
GGACAGAAAGGTGTCCAAGTACCTGTATCACAGCCGCCTACGCCCACCTAG
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_080732
Insert Size 1224 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_080732.3
RefSeq Size 2174 bp
RefSeq ORF 1224 bp
Locus ID 112398
UniProt ID Q96KS0
Cytogenetics 19q13.2
Domains 2OG-FeII_Oxy, P4Hc
Protein Families Druggable Genome
Protein Pathways Pathways in cancer, Renal cell carcinoma
MW 43.7 kDa
Summary The hypoxia inducible factor (HIF) is a transcriptional complex that is involved in oxygen homeostasis. At normal oxygen levels, the alpha subunit of HIF is targeted for degration by prolyl hydroxylation. This gene encodes an enzyme responsible for this post-translational modification. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream RAB4B (RAB4B, member RAS oncogene family) gene. provided by RefSeq, Feb 2011
Transcript Variant: This variant (3) represents the longer transcript. Both variants 1 and 3 utilize alternative start codons that result in expression of two isoforms known as PHD1p43 and PHD1p40.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_080732" in other vectors (5)
SKU Description Size Price
RC219191 EGLN2 (Myc-DDK-tagged)-Human egl nine homolog 2 (C. elegans) (EGLN2), transcript variant 3 10 ug
$457.00
RC219191L3 Lenti ORF clone of Human egl nine homolog 2 (C. elegans) (EGLN2), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC219191L4 Lenti ORF clone of Human egl nine homolog 2 (C. elegans) (EGLN2), transcript variant 3, mGFP tagged 10 ug
$757.00
RG219191 EGLN2 (tGFP-tagged) - Human egl nine homolog 2 (C. elegans) (EGLN2), transcript variant 3 10 ug
$489.00 $657.00
SC110740 EGLN2 (untagged)-Human egl nine homolog 2 (C. elegans) (EGLN2), transcript variant 3 10 ug
$150.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products