OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

GPR34 (NM_001097579) Human Untagged Clone

Be the first to review this product
SKU
SC316196
GPR34 (untagged)-Human G protein-coupled receptor 34 (GPR34), transcript variant 4
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA313952 Rabbit polyclonal anti-GPR34 antibody
100 ul
$380.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "GPR34 or NM_001097579"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GPR34
Synonyms LYPSR1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC316196 representing NM_001097579.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGAAGTCATACCATAACAATGACGACAACTTCAGTCAGCAGCTGGCCTTACTCCTCCCACAGAATG
CGCTTTATAACCAATCATAGCGACCAACCGCCACAAAACTTCTCAGCAACACCAAATGTTACTACCTGT
CCCATGGATGAAAAATTGCTATCTACTGTGTTAACCACATCCTACTCTGTTATTTTCATCGTGGGACTG
GTTGGGAACATAATCGCCCTCTATGTATTTCTGGGTATTCACCGTAAAAGAAATTCCATTCAAATTTAT
CTACTTAACGTAGCCATTGCAGACCTCCTACTCATCTTCTGCCTCCCTTTCCGAATAATGTATCATATT
AACCAAAACAAGTGGACACTAGGTGTGATTCTGTGCAAGGTTGTGGGAACACTGTTTTATATGAACATG
TACATTAGCATTATTTTGCTTGGATTCATCAGTTTGGATCGCTATATAAAAATTAATCGGTCTATACAG
CAACGGAAGGCAATAACAACCAAACAAAGTATTTATGTCTGTTGTATAGTATGGATGCTTGCTCTTGGT
GGATTCCTAACTATGATTATTTTAACACTTAAGAAAGGAGGGCATAATTCCACAATGTGTTTCCATTAC
AGAGATAAGCATAACGCAAAAGGAGAAGCCATTTTTAACTTCATTCTTGTGGTAATGTTCTGGCTAATT
TTCTTACTAATAATCCTTTCATATATTAAGATTGGGAAGAATCTATTGAGGATTTCTAAAAGGAGGTCA
AAATTTCCTAATTCTGGTAAATATGCCACTACAGCTCGTAACTCCTTTATTGTACTTATCATTTTTACT
ATATGTTTTGTTCCCTATCATGCCTTTCGATTCATCTACATTTCTTCACAGCTAAATGTATCATCTTGC
TACTGGAAAGAAATTGTTCACAAAACCAATGAGATCATGCTGGTTCTCTCATCTTTCAATAGTTGCTTA
GATCCAGTCATGTATTTCCTGATGTCCAGTAACATTCGCAAAATAATGTGCCAACTTCTTTTTAGACGA
TTTCAAGGTGAACCAAGTAGGAGTGAAAGCACTTCAGAATTTAAACCAGGATACTCCCTGCATGATACA
TCTGTGGCAGTGAAAATACAGTCTAGTTCTAAAAGTACTTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001097579
Insert Size 1146 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001097579.1
RefSeq Size 1938 bp
RefSeq ORF 1146 bp
Locus ID 2857
UniProt ID Q9UPC5
Cytogenetics Xp11.4
Protein Families Druggable Genome, GPCR, Transmembrane
MW 43.9 kDa
Summary G protein-coupled receptors (GPCRs), such as GPR34, are integral membrane proteins containing 7 putative transmembrane domains (TMs). These proteins mediate signals to the interior of the cell via activation of heterotrimeric G proteins that in turn activate various effector proteins, ultimately resulting in a physiologic response.supplied by OMIM, Apr 2006
Transcript Variant: This variant (4) represents the longer transcript. Both variants 1 and 4 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001097579" in other vectors (6)
SKU Description Size Price
RC223795 GPR34 (Myc-DDK-tagged)-Human G protein-coupled receptor 34 (GPR34), transcript variant 4 10 ug
$289.00 $457.00
RC223795L1 Lenti ORF clone of Human G protein-coupled receptor 34 (GPR34), transcript variant 4, Myc-DDK-tagged 10 ug
$757.00
RC223795L2 Lenti ORF clone of Human G protein-coupled receptor 34 (GPR34), transcript variant 4, mGFP tagged 10 ug
$757.00
RC223795L3 Lenti ORF clone of Human G protein-coupled receptor 34 (GPR34), transcript variant 4, Myc-DDK-tagged 10 ug
$757.00
RC223795L4 Lenti ORF clone of Human G protein-coupled receptor 34 (GPR34), transcript variant 4, mGFP tagged 10 ug
$757.00
RG223795 GPR34 (tGFP-tagged) - Human G protein-coupled receptor 34 (GPR34), transcript variant 4 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products