OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

BIN1 (NM_139349) Human Untagged Clone

Be the first to review this product
SKU
SC311387
BIN1 (untagged)-Human bridging integrator 1 (BIN1), transcript variant 7
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA319580 Anti-BIN1 (MOUSE) Monoclonal Antibody, 100 ug
100 ug
$890.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "BIN1 or NM_139349"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol BIN1
Synonyms AMPH2; AMPHL; CNM2; SH3P9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC311387 representing NM_139349.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGAGATGGGCAGTAAAGGGGTGACGGCGGGAAAGATCGCCAGCAACGTGCAGAAGAAGCTCACC
CGCGCGCAGGAGAAGGTTCTCCAGAAGCTGGGGAAGGCAGATGAGACCAAGGATGAGCAGTTTGAGCAG
TGCGTCCAGAATTTCAACAAGCAGCTGACGGAGGGCACCCGGCTGCAGAAGGATCTCCGGACCTACCTG
GCCTCCGTCAAAGCCATGCACGAGGCTTCCAAGAAGCTGAATGAGTGTCTGCAGGAGGTGTATGAGCCC
GATTGGCCCGGCAGGGATGAGGCAAACAAGATCGCAGAGAACAACGACCTGCTGTGGATGGATTACCAC
CAGAAGCTGGTGGACCAGGCGCTGCTGACCATGGACACGTACCTGGGCCAGTTCCCCGACATCAAGTCA
CGCATTGCCAAGCGGGGGCGCAAGCTGGTGGACTACGACAGTGCCCGGCACCACTACGAGTCCCTTCAA
ACTGCCAAAAAGAAGGATGAAGCCAAAATTGCCAAGGCCGAGGAGGAGCTCATCAAAGCCCAGAAGGTG
TTTGAGGAGATGAATGTGGATCTGCAGGAGGAGCTGCCGTCCCTGTGGAACAGCCGCGTAGGTTTCTAC
GTCAACACGTTCCAGAGCATCGCGGGCCTGGAGGAAAACTTCCACAAGGAGATGAGCAAGCTCAACCAG
AACCTCAATGATGTGCTGGTCGGCCTGGAGAAGCAACACGGGAGCAACACCTTCACGGTCAAGGCCCAG
CCCAGTGACAACGCGCCTGCAAAAGGGAACAAGAGCCCTTCGCCTCCAGATGGCTCCCCTGCCGCCACC
CCCGAGATCAGAGTCAACCACGAGCCAGAGCCGGCCGGCGGGGCCACGCCCGGGGCCACCCTCCCCAAG
TCCCCATCTCAGCCCACAGAGAGTCCAGCCGGCAGCCTGCCTTCCGGGGAGCCCAGCGCTGCCGAGGGC
ACCTTTGCTGTGTCCTGGCCCAGCCAGACGGCCGAGCCGGGGCCTGCCCAACCAGCAGAGGCCTCGGAG
GTGGCGGGTGGGACCCAACCTGCGGCTGGAGCCCAGGAGCCAGGGGAGACGGCGGCAAGTGAAGCAGCC
TCCAGCTCTCTTCCTGCTGTCGTGGTGGAGACCTTCCCAGCAACTGTGAATGGCACCGTGGAGGGCGGC
AGTGGGGCCGGGCGCTTGGACCTGCCCCCAGGTTTCATGTTCAAGGTACAGGCCCAGCACGACTACACG
GCCACTGACACAGACGAGCTGCAGCTCAAGGCTGGTGATGTGGTGCTGGTGATCCCCTTCCAGAACCCT
GAAGAGCAGGATGAAGGCTGGCTCATGGGCGTGAAGGAGAGCGACTGGAACCAGCACAAGGAGCTGGAG
AAGTGCCGTGGCGTCTTCCCCGAGAACTTCACTGAGAGGGTCCCATGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_139349
Insert Size 1428 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_139349.2
RefSeq Size 2332 bp
RefSeq ORF 1428 bp
Locus ID 274
UniProt ID O00499
Cytogenetics 2q14.3
MW 51.7 kDa
Summary This gene encodes several isoforms of a nucleocytoplasmic adaptor protein, one of which was initially identified as a MYC-interacting protein with features of a tumor suppressor. Isoforms that are expressed in the central nervous system may be involved in synaptic vesicle endocytosis and may interact with dynamin, synaptojanin, endophilin, and clathrin. Isoforms that are expressed in muscle and ubiquitously expressed isoforms localize to the cytoplasm and nucleus and activate a caspase-independent apoptotic process. Studies in mouse suggest that this gene plays an important role in cardiac muscle development. Alternate splicing of the gene results in several transcript variants encoding different isoforms. Aberrant splice variants expressed in tumor cell lines have also been described. provided by RefSeq, Mar 2016
Transcript Variant: This variant (7) lacks three in-frame exons in the coding region, compared to variant 1. Isoform 7, also called IIc2 and S1/R3-c, is shorter than isoform 1 and binds dynamin and synaptojanin.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_139349" in other vectors (6)
SKU Description Size Price
RC214334 BIN1 (Myc-DDK-tagged)-Human bridging integrator 1 (BIN1), transcript variant 7 10 ug
$457.00
RC214334L1 Lenti ORF clone of Human bridging integrator 1 (BIN1), transcript variant 7, Myc-DDK-tagged 10 ug
$757.00
RC214334L2 Lenti ORF clone of Human bridging integrator 1 (BIN1), transcript variant 7, mGFP tagged 10 ug
$757.00
RC214334L3 Lenti ORF clone of Human bridging integrator 1 (BIN1), transcript variant 7, Myc-DDK-tagged 10 ug
$757.00
RC214334L4 Lenti ORF clone of Human bridging integrator 1 (BIN1), transcript variant 7, mGFP tagged 10 ug
$757.00
RG214334 BIN1 (tGFP-tagged) - Human bridging integrator 1 (BIN1), transcript variant 7 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products