OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

DUSP10 (NM_144729) Human Untagged Clone

Be the first to review this product
SKU
SC310672
DUSP10 (untagged)-Human dual specificity phosphatase 10 (DUSP10), transcript variant 3
  $165.00
2 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA806771 DUSP10 mouse monoclonal antibody, clone OTI2H1 (formerly 2H1) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "DUSP10 or NM_144729"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DUSP10
Synonyms MKP-5; MKP5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC310672 representing NM_144729.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGCGGCTGAACATCGGCTACGTCATCAACGTCACCACTCATCTTCCCCTCTACCACTATGAGAAA
GGCCTGTTCAACTACAAGCGGCTGCCAGCCACTGACAGCAACAAGCAGAACCTGCGGCAGTACTTTGAA
GAGGCTTTTGAGTTCATTGAGGAAGCTCACCAGTGTGGGAAGGGGCTTCTCATCCACTGCCAGGCTGGG
GTGTCCCGCTCCGCCACCATCGTCATCGCTTACTTGATGAAGCACACTCGGATGACCATGACTGATGCT
TATAAATTTGTCAAAGGCAAACGACCAATTATCTCCCCAAACCTTAACTTCATGGGGCAGTTGCTAGAG
TTCGAGGAAGACCTAAACAACGGTGTGACACCGAGAATCCTTACACCAAAGCTGATGGGCGTGGAGACG
GTTGTGTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_144729
Insert Size 423 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_144729.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_144729.2
RefSeq Size 1824 bp
RefSeq ORF 423 bp
Locus ID 11221
Cytogenetics 1q41
Domains DSPc
Protein Families Druggable Genome, Phosphatase
Protein Pathways MAPK signaling pathway
MW 16.1 kDa
Summary Dual specificity protein phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the MAP kinase superfamily, which is associated with cellular proliferation and differentiation. Different members of this family of dual specificity phosphatases show distinct substrate specificities for MAP kinases, different tissue distribution and subcellular localization, and different modes of expression induction by extracellular stimuli. This gene product binds to and inactivates p38 and SAPK/JNK. Alternative splicing results in multiple transcript variants. provided by RefSeq, Apr 2014
Transcript Variant: This variant (3) differs in the 5' UTR and coding region compared to variant 1, resulting in an isoform (b) that is shorter at the N-terminus compared to isoform a. Both variants 2 and 3 encode isoform b.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_144729" in other vectors (4)
SKU Description Size Price
RC211820 DUSP10 (Myc-DDK-tagged)-Human dual specificity phosphatase 10 (DUSP10), transcript variant 3 10 ug
$457.00
RC211820L3 Lenti ORF clone of Human dual specificity phosphatase 10 (DUSP10), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC211820L4 Lenti ORF clone of Human dual specificity phosphatase 10 (DUSP10), transcript variant 3, mGFP tagged 10 ug
$757.00
RG211820 DUSP10 (tGFP-tagged) - Human dual specificity phosphatase 10 (DUSP10), transcript variant 3 10 ug
$489.00 $657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products