PRH2 (NM_005042) Human Untagged Clone

SKU SC303565

PRH2 (untagged)-Human proline-rich protein HaeIII subfamily 2 (PRH2), transcript variant 1

Product Data

• Type: Human Untagged Clone
• Target Symbol: PRH2
• Synonyms: db-s; pa; PIF-S; Pr; pr1/Pr2; PRH1; PRP-1/PRP-2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC303565 representing NM_005042.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGCTTCTGATTCTGCTGTCAGTGGCCCTGCTGGCCTTCAGCTCAGCTCAGGACTTAGATGAAGATGTC; AGCCAAGAAGACGTTCCCTTGGTAATATCAGATGGAGGAGACTCTGAGCAGTTCATAGATGAGGAGCGT; CAGGGACCACCTTTGGGAGGACAGCAATCTCAACCCTCTGCTGGTGATGGGAACCAGAATGATGGCCCT; CAGCAGGGACCACCCCAACAAGGAGGCCAGCAGCAACAAGGTCCACCACCTCCTCAGGGAAAGCCACAA; GGACCACCCCAACAGGGAGGCCATCCCCCTCCTCCTCAAGGAAGGCCACAAGGACCACCCCAACAGGGA; GGCCATCCCCGTCCTCCTCGAGGAAGGCCACAAGGACCACCCCAACAGGGAGGCCATCAGCAAGGTCCT; CCCCCACCTCCTCCTGGAAAGCCCCAGGGACCACCTCCCCAAGGGGGCCGCCCACAAGGACCTCCACAG; GGGCAGTCTCCTCAGTAA; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_005042
• Insert Size: 501 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_005042.4
• RefSeq Size: 4323 bp
• RefSeq ORF: 501 bp
• Locus ID: 5555
• Cytogenetics: 12p13.2
• Protein Families: Secreted Protein
• MW: 17 kDa
• Summary: This gene encodes a member of the heterogeneous family of proline-rich salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature isoforms before secretion from the parotid and submandibular/sublingual glands. In western population this locus is commonly biallelic and encodes proline-rich protein (PRP) isoforms, PRP-1 and PRP-2. The reference genome encodes the PRP-1 allele. Certain alleles of this gene are associated with susceptibility to dental caries. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 12. [provided by RefSeq, Oct 2015]; Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.