OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ALG11 (NM_001004127) Human Untagged Clone

Be the first to review this product
SKU
SC300606
ALG11 (untagged)-Human asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast) (ALG11), transcript variant A
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA350849 Rabbit Polyclonal Anti-ALG11 Antibody
100 ul
$205.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "ALG11 or NM_001004127"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ALG11
Synonyms CDG1P; GT8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC300606 representing NM_001004127.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCCGGCGAAAGGAGCTGGTGCCTGTGCAAGTTGTTGAGGTTTTTTTATTCATTATTCTTCCCT
GGGCTCATTGTATGTGGAACTTTATGTGTGTGTTTGGTCATTGTCCTTTGGGGAATCAGACTGCTGCTA
CAGAGAAAGAAAAAATTAGTGTCAACTAGCAAAAATGGGAAAAATCAAATGGTGATTGCATTTTTTCAT
CCATACTGCAATGCTGGTGGAGGAGGAGAAAGAGTTTTATGGTGTGCTTTAAGAGCCCTGCAGAAAAAG
TATCCTGAAGCAGTTTATGTTGTTTATACCGGCGATGTTAATGTCAACGGTCAACAGATACTAGAAGGT
GCTTTCAGAAGATTTAACATCAGATTAATTCACCCAGTGCAGTTTGTTTTTTTAAGGAAACGCTATCTT
GTGGAAGATTCACTGTATCCTCACTTCACACTGCTGGGCCAAAGTCTAGGATCCATTTTTCTTGGCTGG
GAAGCTCTAATGCAGTGTGTTCCTGATGTTTACATTGATTCAATGGGATACGCTTTTACGCTTCCTCTG
TTTAAGTATATAGGGGGTTGCCAAGTTGGAAGCTATGTTCATTATCCTACTATCAGCACCGACATGCTC
TCTGTAGTGAAGAATCAAAATATTGGATTTAATAATGCAGCCTTCATTACCAGGAATCCTTTTCTCAGC
AAAGTAAAGCTCATCTACTACTATTTATTTGCTTTTATTTATGGACTTGTTGGTTCTTGCAGTGATGTA
GTCATGGTCAATTCTTCTTGGACACTAAACCATATTCTCTCACTATGGAAAGTTGGGAATTGCACTAAC
ATTGTTTATCCACCTTGTGATGTGCAGACATTTCTGGACATTCCCTTACATGAGAAAAAGATGACCCCA
GGACATTTGCTGGTTTCTGTTGGCCAGTTTAGGCCGGAAAAGAATCATCCATTGCAGATCAGAGCCTTT
GCTAAATTGCTGAATAAGAAGATGGTTGAGTCACCTCCTTCGCTTAAACTTGTCCTCATTGGAGGTTGT
CGTAACAAAGATGATGAACTTAGGGTAAACCAACTGAGAAGGCTGTCTGAGGATTTAGGAGTTCAAGAA
TATGTGGAATTTAAAATAAACATTCCATTTGATGAATTAAAGAATTATTTGTCTGAAGCAACAATTGGT
CTGCATACCATGTGGAACGAGCATTTTGGGATTGGAGTTGTGGAGTGTATGGCAGCTGGCACAATTATC
CTTGCACACAATTCGGGGGGCCCAAAGCTTGACATTGTGGTTCCTCACGAAGGAGATATAACTGGCTTT
CTGGCTGAGAGTGAAGAAGACTATGCTGAAACTATCGCTCACATTCTTTCCATGTCTGCAGAAAAGAGA
CTCCAAATCAGAAAAAGTGCTCGTGCATCTGTAAGCAGATTCTCTGATCAGGAATTTGAAGTGACATTC
CTATCATCTGTGGAAAAGTTATTTAAGTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001004127
Insert Size 1479 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001004127.2
RefSeq Size 2595 bp
RefSeq ORF 1479 bp
Locus ID 440138
UniProt ID Q2TAA5
Cytogenetics 13q14.3
Protein Families Transmembrane
Protein Pathways Metabolic pathways, N-Glycan biosynthesis
MW 55.7 kDa
Summary This gene encodes a GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase which is localized to the cytosolic side of the endoplasmic reticulum (ER) and catalyzes the transfer of the fourth and fifth mannose residue from GDP-mannose (GDP-Man) to Man3GlcNAc2-PP-dolichol and Man4GlcNAc2-PP-dolichol resulting in the production of Man5GlcNAc2-PP-dolichol. Mutations in this gene are associated with congenital disorder of glycosylation type Ip (CDGIP). This gene overlaps but is distinct from the UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) gene. A pseudogene of the GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase has been identified on chromosome 19. provided by RefSeq, Aug 2010
Transcript Variant: This variant (A) represents the longer transcript and encodes the functional protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001004127" in other vectors (4)
SKU Description Size Price
RC218890 ALG11 (Myc-DDK-tagged)-Human asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast) (ALG11), transcript variant A 10 ug
$457.00
RC218890L3 Lenti ORF clone of Human asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast) (ALG11), transcript variant A, Myc-DDK-tagged 10 ug
$757.00
RC218890L4 Lenti ORF clone of Human asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast) (ALG11), transcript variant A, mGFP tagged 10 ug
$757.00
RG218890 ALG11 (tGFP-tagged) - Human asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast) (ALG11), transcript variant A 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products