SLIT2 (NM_004787) Human Tagged ORF Clone
$1,961.00
In Stock*
Specifications
| Product Data | |
| Type | Human Tagged ORF Clone |
|---|---|
| Target Symbol | SLIT2 |
| Synonyms | SLIL3; Slit-2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data | |
| Chromatograms |
Chromatograms
 Sequencher program is needed, download here |
| Restriction Sites |
SgfI-MluI Cloning Scheme for this gene
|
Plasmid Map
|
| ACCN | NM_004787 |
| ORF Size | 4587 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
| Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_004787.4 |
| RefSeq Size | 4950 bp |
| RefSeq ORF | 4590 bp |
| Locus ID | 9353 |
| UniProt ID | O94813 |
| Cytogenetics | 4p15.31 |
| Domains | CT, EGF, EGF_CA, LamG, LRR, LRRCT, LRRNT, LRR_PS, LRR_TYP |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | Axon guidance |
| MW | 169.7 kDa |
| Summary | This gene encodes a member of the slit family of secreted glycoproteins, which are ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. Members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Proteolytic processing of this protein gives rise to an N-terminal fragment that contains the four leucine-rich repeats and five epidermal growth factor repeats and a C-terminal fragment that contains four epidermal growth factor repeats and the cysteine knot. Both full length and cleaved proteins are secreted extracellularly and can function in axon repulsion as well as other specific processes. Alternative splicing results in multiple transcript variants. provided by RefSeq, Sep 2015 |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
"NM_004787" in other vectors (6)
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| RC220894L1 | Lenti ORF clone of Human slit homolog 2 (Drosophila) (SLIT2), Myc-DDK-tagged | 10 ug |
$2,261.00
|
|
| RC220894L2 | Lenti ORF clone of Human slit homolog 2 (Drosophila) (SLIT2), mGFP tagged | 10 ug |
$2,261.00
|
|
| RC220894L3 | Lenti ORF clone of Human slit homolog 2 (Drosophila) (SLIT2), Myc-DDK-tagged | 10 ug |
$2,261.00
|
|
| RC220894L4 | Lenti ORF clone of Human slit homolog 2 (Drosophila) (SLIT2), mGFP tagged | 10 ug |
$2,261.00
|
|
| RG220894 | SLIT2 (tGFP-tagged) - Human slit homolog 2 (Drosophila) (SLIT2) | 10 ug |
$2,161.00
|
|
| SC316293 | SLIT2 (untagged)-Human slit homolog 2 (Drosophila) (SLIT2) | 10 ug |
$1,963.00
|
|
Citations
The role of Slit2 as a tumor suppressor in thyroid cancer
Jeon, Lim, You et al
Mol. Cell. Endocrinol. (2019) 483, 87-96 DOI: 10.1016/j.mce.2019.01.010
Jeon, Lim, You et al
Mol. Cell. Endocrinol. (2019) 483, 87-96 DOI: 10.1016/j.mce.2019.01.010
AI Summary: OriGene’s Slit2 open reading frame cDNA clones were used in this study to overexpress Slit2 in thyroid cancer cells, enabling the investigation of Slit2’s tumor suppressor role.
Snippet: 2.1. Reagents. Media and cell culture reagents were purchased from GIBCO (Grand Island, NY). Slit2 open reading frame cDNA clones were purchased from Origene (Rockville, MD, USA) and shRNA lentiviral vectors were purchased from Sigma-Aldrich (Darmstadt
Slit2N Inhibits Transmission of HIV-1 from Dendritic Cells to T-cells by Modulating Novel Cytoskeletal Elements
Shrivastava, Prasad, Kuzontkoski et al
Sci Rep (2015) 5, 16833 DOI: 10.1038/srep16833
Shrivastava, Prasad, Kuzontkoski et al
Sci Rep (2015) 5, 16833 DOI: 10.1038/srep16833
Cited by 20
AI Summary: OriGene's PCMV-ENTRY-Slit2N plasmid was used as the template to amplify the Slit2N gene, enabling the study of Slit2N’s effects on HIV-1 transmission between dendritic cells and T-cells.
Snippet: To construct the Slit2N ENTRY clone, the Slit2N gene was amplified from PCMV-ENTRY-Slit2N (OriGene Technologies, Inc., Rockville, MD) using the following primers: 5′- CACCATGCGCGGCGTTGGCTGGCAGATGC -3′ and 5′- GGGACCATGGGTG ... Cite SaveSaving
Slit-2 Induces a Tumor-suppressive Effect by Regulating ß-Catenin in Breast Cancer Cells
Prasad, Paruchuri, Preet et al
J. Biol. Chem (2008)
Prasad, Paruchuri, Preet et al
J. Biol. Chem (2008)
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
