PFKFB4 (NM_004567) Human Tagged ORF Clone
SKU
RC201573
PFKFB4 (Myc-DDK-tagged)-Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 (PFKFB4)
$457.00
In Stock*
Specifications
| Product Data | |
| Type | Human Tagged ORF Clone |
|---|---|
| Target Symbol | PFKFB4 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data | |
| Chromatograms |
Chromatograms
 Sequencher program is needed, download here |
| Restriction Sites |
SgfI-MluI Cloning Scheme for this gene
|
Plasmid Map
|
| ACCN | NM_004567 |
| ORF Size | 1407 bp |
| OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
| Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_004567.4 |
| RefSeq Size | 3503 bp |
| RefSeq ORF | 1410 bp |
| Locus ID | 5210 |
| UniProt ID | Q16877 |
| Cytogenetics | 3p21.31 |
| Domains | 6PF2K, PGAM |
| Protein Families | Druggable Genome |
| Protein Pathways | Fructose and mannose metabolism |
| MW | 54 kDa |
| Summary | The protein encoded by this gene is one of four bifunctional kinase/phosphatases that regulate the concentration of the glycolytic byproduct fructose-2,6-bisphosphate (F2,6BP). The encoded protein is highly expressed in cancer cells and is induced by hypoxia. This protein is essential to the survival of cancer cells under conditions of hypoxia, because it increases the amount of F2,6BP and ATP at a time when the cell cannot produce much of them. This finding suggests that this protein may be a good target for disruption in cancer cells, hopefully imperiling their survival. Several transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Nov 2015 |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
"NM_004567" in other vectors (7)
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| RC201573L1 | Lenti ORF clone of Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 (PFKFB4), Myc-DDK-tagged | 10 ug |
$757.00
|
|
| RC201573L2 | Lenti ORF clone of Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 (PFKFB4), mGFP tagged | 10 ug |
$757.00
|
|
| RC201573L3 | Lenti ORF clone of Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 (PFKFB4), Myc-DDK-tagged | 10 ug |
$757.00
|
|
| RC201573L4 | Lenti ORF clone of Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 (PFKFB4), mGFP tagged | 10 ug |
$757.00
|
|
| RG201573 | PFKFB4 (tGFP-tagged) - Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 (PFKFB4) | 10 ug |
$489.00
$657.00
|
|
| SC110972 | PFKFB4 (untagged)-Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 (PFKFB4) | 10 ug |
$457.00
|
|
| SC323929 | PFKFB4 (untagged)-Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 (PFKFB4) | 10 ug |
$457.00
|
|
Citations
Hypoxic activation of PFKFB4 in breast tumor microenvironment shapes metabolic and cellular plasticity to accentuate metastatic competence
Dai, Rosario, Katsuta et al
Cell Rep (2022) 41 (10), 111756 DOI: 10.1016/j.celrep.2022.111756
Dai, Rosario, Katsuta et al
Cell Rep (2022) 41 (10), 111756 DOI: 10.1016/j.celrep.2022.111756
Cited by 29
AI Summary: OriGene products—specifically the pLenti ORF clone of Human ITGB3 tagged with mGFP (RC221606L4) and the pLenti ORF clone of Human PFKFB4 tagged with myc-DDK (RC201573L3)—were used in this study to overexpress ITGB3 and PFKFB4 in breast cancer cells, facilitating investigations into their roles in tumor metabolic adaptation and metastasis.
Snippet: V3IMMHER_13710683, V3IMMHER_14783876 SMARTvector Inducible Nontargeting hEF1a-TurboGFP (control 1) Horizon Discovery Cat# VSC11653 pLenti ORF clone of Human ITGB3 tagged with mGFP Origene RC221606L4 pLenti ORF clone of Human PFKFB4 tagged with myc-DDK Origene RC201573L3 pLenti-luciferase-P2A-Neo Xu et al., 201865 Addgene #105621 pLenti HRE-Luc pGK Hyg
PFKFB4 interacts with ICMT and activates RAS/AKT signaling-dependent cell migration in melanoma
Sittewelle, Kappès, Zhou et al
Life Sci Alliance (2022) 5 (12) DOI: 10.26508/lsa.202201377
Sittewelle, Kappès, Zhou et al
Life Sci Alliance (2022) 5 (12) DOI: 10.26508/lsa.202201377
Cited by 14
AI Summary: OriGene products hICMT (clone RC207000) and hPFKFB4 (clone RC201573) were used as expression clones to investigate protein interactions and the role of PFKFB4 in activating RAS/AKT signaling and promoting melanoma cell migration.
Snippet: adapted for mammalian membrane-bound proteins (MaMTH) was used (Petschnigg et al, 2014;Saraon et al, 2017). Cloning used Gibson method ([Gibson et al, 2009], primers used in Table S3). hICMT (clone Origene no. RC207000) and hPFKFB4 (clone Origene no. RC201573) were inserted in-frame into the MaMTH bait destination vector, which contains ubiquitin C-terminal half fused to the yeast GAL4 DNA-bindi
The glycolysis regulator PFKFB4 interacts with ICMT and activates RAS/AKT signaling-dependent cell migration in melanoma
Sittewelle, Lecuyer, Monsoro-Burq
bioRxiv (2020)
Sittewelle, Lecuyer, Monsoro-Burq
bioRxiv (2020)
Cited by 9
Snippet: … hICMT (clone Origene n°RC207000) and hPFKFB4 (clone Origene n°RC201573) were inserted in-frame into the pBIND backbone vector, which contains the yeast GAL4;- Cloning used Gibson method ((59), primers used in Table S3). hICMT (clone Origene n°RC207000) and hPFKFB4 (clone Origene n°RC201573) were inserted in-frame into the pBIND backbone vector, which contains the yeast GAL4
Metabolic enzyme PFKFB4 activates transcriptional coactivator SRC-3 to drive breast cancer
Dasgupta, Rajapakshe, Zhu et al
Nature (2018) 556 (7700), 249-254 DOI: 10.1038/s41586-018-0018-1
Dasgupta, Rajapakshe, Zhu et al
Nature (2018) 556 (7700), 249-254 DOI: 10.1038/s41586-018-0018-1
AI Summary: OriGene contributed to this study by providing the human PFKFB4 cDNA (catalog number RC201573), which was used to investigate the role of PFKFB4 in activating SRC-3 and driving breast cancer progression.
Snippet: … The human PFKFB4 cDNA (NM_004567.3) was obtained from Origene (RC201573). The PFKFB4 mutants Gly46Ala, Pro48Ala, Gly51Ala, Arg230Ala and Arg238Ala were generated by site-directed mutagenesis. …
6-Phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 is essential for p53-null cancer cells
Ros, Flöter, Kaymak et al
Oncogene (2017)
Ros, Flöter, Kaymak et al
Oncogene (2017)
AI Summary: OriGene's Hs_PFKFB4 cDNA was used as the template for cloning and functional studies of PFKFB4 in this paper, enabling the authors to investigate its essential role in supporting metabolism and survival of p53-deficient cancer cells.
Snippet: The Hs_PFKFB4 cDNA was obtained from Origene and used as template for cloning into pBabe-blast using the BD In Fusion PCR Cloning kit (Clontech, Takara, Mountain View, CA, USA) and the following primers: (forward 5′- TCTAGGCGCCGGCCGATGGCGTCCCAACGG and reverse 5′-CTGTGCTGGCGAATTTCACTGGTGAGCAGG)
Showing 1-5 of 5 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
