OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Irf7 (NM_016850) Mouse Tagged ORF Clone

  • TrueORF®
Be the first to review this product
SKU
MR225814
Irf7 (Myc-DDK-tagged) - Mouse interferon regulatory factor 7 (Irf7)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
DDK tGFP
Lentiviral Particles:
DDK w/ Puro mGFP w/ Puro
AAV Particle:
DDK
$289.00 $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (5)

TA592569S DDK Rabbit monoclonal antibody, recognizing both N- and C-terminal tags
30 ul
$200.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
PS100001 pCMV6-Entry, mammalian vector with C-terminal Myc- DDK Tag, 10ug
10 ug
$670.00
AR100028M DDKTrap Anti-DDK 8G6 affinity resin used for the purification of DDK, DYKDDDDK, or FLAG® tagged proteins , 5 mL
5 ml
$750.00

Other products for "Irf7 or NM_016850"

Specifications
Specifications
Product Data
Type Mouse Tagged ORF Clone
Target Symbol Irf7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
ORF Nucleotide Sequence
>MR225814 representing NM_016850
Red=Cloning site Blue=ORF Green=Tags(s)

CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGAAGTGAGGGGGGTCCAGCGAGTGCTGTTTGGAGACTGGCTATTGGGGGAGGTCAGCAGCGGCC
AGTACGAGGGGCTGCAGTGGCTGAACGAGGCTCGCACAGTCTTCCGCGTACCCTGGAAGCATTTCGGTCG
TAGGGATCTGGATGAAGAAGATGCACAGATCTTCAAGGCCTGGGCTGTGGCCCGAGGGAGGTGGCCACCT
AGTGGAGTTAACCTGCCACCCCCAGAGGCTGAGGCTGCTGAGCGAAGAGAGCGAAGAGGCTGGAAGACCA
ACTTCCGCTGTGCACTCCACAGCACAGGGCGTTTTATCTTGCGCCAAGACAATTCAGGGGATCCAGTTGA
TCCGCATAAGGTGTACGAACTTAGCCGGGAGCTTGGATCTACTGTGGGCCCAGCCACGGAAAATAGGGAA
GAAGTGAGCCTCAGCAATGCTCTGCCCACACAGGGTGTGTCCCCAGGATCATTTCTGGCAAGAGAAAATG
CTGGGCTCCAAACCCCAAGCCCTCTGCTTTCTAGTGATGCCGGGGACCTCTTGCTTCAGGTTCTGCAGTA
CAGCCACATACTGGAATCCGAGTCTGGGGCAGACCCCGTCCCACCACAGGCTCCTGGCCAGGAGCAAGAC
CGTGTTTACGAGGAACCCTATGCAGCATGGCAGGTGGAAGCTGTCCCCAGTCCCAGGCCTCAACAGCCAG
CTCTCACCGAGCGCAGCCTTGGGTTCCTGGATGTGACCATCATGTACAAGGGCCGCACAGTGCTACAGGC
AGTGGTGGGGCACCCCAGATGCGTGTTCCTGTACAGCCCCATGGCCCCAGCAGTAAGAACTTCAGAGCCC
CAGCCGGTGATCTTTCCCAGTCCTGCTGAGCTCCCAGATCAGAAGCAGCTGCACTACACAGAGACGCTTC
TCCAGCATGTGTCTCCCGGCCTTCAGCTGGAGCTTCGAGGACCGTCACTGTGGGCCCTGCGTATGGGCAA
GTGCAAGGTGTACTGGGAGGTAGGCAGCCCTATGGGCACTACCGGCCCCTCCACCCCACCCCAGCTGCTG
GAGCGCAACCGCCACACCCCCATCTTCGACTTCAGCACTTTCTTCCGAGAACTGGAGGAGTTTCGGGCTC
GGAGGCGGCAAGGGTCACCACACTACACCATCTACCTGGGTTTTGGGCAAGACTTGTCAGCAGGGAGGCC
CAAGGAGAAGACCCTGATCCTGGTGAAGCTGGAGCCATGGGTATGCAAGGCATACCTGGAGGGCGTGCAG
CGTGAGGGTGTGTCCTCCCTGGACAGCAGCAGTCTCGGCTTGTGCTTGTCTAGCACCAACAGTCTCTACG
AAGACATCGAACACTTCCTCATGGACCTGGGTCAGTGGCCT

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI Cloning Scheme for this gene | Plasmid Map
ACCN NM_016850
ORF Size 1371 bp
OTI Disclaimer The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016850.3, NP_058546.1
RefSeq Size 1830 bp
RefSeq ORF 1374 bp
Locus ID 54123
UniProt ID P70434
Cytogenetics 7 F5
MW 51.7 kDa
Summary Key transcriptional regulator of type I interferon (IFN)-dependent immune responses and plays a critical role in the innate immune response against DNA and RNA viruses (PubMed:27129230). Regulates the transcription of type I IFN genes (IFN-alpha and IFN-beta) and IFN-stimulated genes (ISG) by binding to an interferon-stimulated response element (ISRE) in their promoters. Can efficiently activate both the IFN-beta (IFNB) and the IFN-alpha (IFNA) genes and mediate their induction via both the virus-activated, MyD88-independent pathway and the TLR-activated, MyD88-dependent pathway. Induces transcription of ubiquitin hydrolase USP25 mRNA in response to lipopolysaccharide (LPS) or viral infection in a type I IFN-dependent manner (PubMed:27129230). Required during both the early and late phases of the IFN gene induction but is more critical for the late than for the early phase. Exists in an inactive form in the cytoplasm of uninfected cells and following viral infection, double-stranded RNA (dsRNA), or toll-like receptor (TLR) signaling, becomes phosphorylated by IKBKE and TBK1 kinases. This induces a conformational change, leading to its dimerization and nuclear localization where along with other coactivators it can activate transcription of the type I IFN and ISG genes. Can also play a role in regulating adaptive immune responses by inducing PSMB9/LMP2 expression, either directly or through induction of IRF1. Binds to the Q promoter (Qp) of EBV nuclear antigen 1 a (EBNA1) and may play a role in the regulation of EBV latency. Can activate distinct gene expression programs in macrophages and regulate the anti-tumor properties of primary macrophages.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_016850" in other vectors (4)
SKU Description Size Price
MC216147 Irf7 (untagged) - Mouse interferon regulatory factor 7 (Irf7), (10ug) 10 ug
$503.00
MG225814 Irf7 (tGFP-tagged) - Mouse interferon regulatory factor 7 (Irf7), (10ug) 10 ug
$489.00 $657.00
MR225814L3 Lenti ORF clone of Irf7 (Myc-DDK-tagged) - Mouse interferon regulatory factor 7 (Irf7) 10 ug
$757.00
MR225814L4 Lenti ORF clone of Irf7 (mGFP-tagged) - Mouse interferon regulatory factor 7 (Irf7) 10 ug
$757.00

Plasmid Map for MR225814

Download sequence for

file-download TXT (FASTA format)

file-download Genbank

Cloning scheme for MR225814
Circular map for MR225814

file-alt Citations

Myeloid neddylation targets IRF7 and promotes host innate immunity against RNA viruses
Zhao, Zhang, Yang et al
PLoS Pathog (2021) 17 (9), e1009901 DOI: 10.1371/journal.ppat.1009901
Cited by 29
AI Summary: OriGene products contributed to this study by providing the IRF7 (Cat# RC221744) and IRF5 (Cat# RC211082) expression plasmids, which were used to investigate the roles of these proteins in neddylation-mediated innate immune responses against RNA viruses.
FigureFigureFigure
RACK1 T50 Phosphorylation by AMPK Potentiates Its Binding with IRF3/7 and Inhibition of Type 1 IFN Production
Qin, Niu, Shen et al
J Immunol (2021) 207 (5), 1411-1418 DOI: 10.4049/jimmunol.2100086
Cited by 17
AI Summary: In this study, OriGene's mammalian expression vectors encoding FLAG-Myc-tagged murine IRF7 (MR225814) and FLAG-tagged human IRF3 (HG12007) were used to investigate the interactions between RACK1 and IRF3/7, helping elucidate the molecular mechanisms by which RACK1 regulates type 1 IFN production during viral infection.
Snippet: previously (11-13). Mammalian expression vectors encoding FLAG-Myc-tagged murine IRF7 (MR225814) and FLAG-tagged human IRF3 (HG12007) were purchased from OriGene and Sino Biological, respectively. Mutations of
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products