Tead4 (NM_011567) Mouse Tagged ORF Clone
- TrueORF®
SKU
MR219506
Tead4 (Myc-DDK-tagged) - Mouse TEA domain family member 4 (Tead4), transcript variant 1
$289.00
$457.00
In Stock*
Specifications
| Product Data | |
| Type | Mouse Tagged ORF Clone |
|---|---|
| Target Symbol | Tead4 |
| Synonyms | Etfr; ETFR-; ETFR-2; Etfr2; FR-19; Rtef; Rtef1; Tcf13r; Tcf13r1; TEAD-; TEAD-4; Tef; TEF-3; Tef3; Tefr; Tefr1; Tefr1a |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data | |
| Chromatograms |
Chromatograms
 Sequencher program is needed, download here |
| Restriction Sites |
SgfI-MluI Cloning Scheme for this gene
|
Plasmid Map
|
| ACCN | NM_011567 |
| ORF Size | 1281 bp |
| OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
| Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq Size | 3076 bp |
| RefSeq ORF | 1284 bp |
| Locus ID | 21679 |
| UniProt ID | Q62296 |
| Cytogenetics | 6 62.92 cM |
| MW | 48 kDa |
| Summary | This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is preferentially expressed in the skeletal muscle, and binds to the M-CAT regulatory element found in promoters of muscle-specific genes to direct their gene expression. This factor may play a role in the embryonic development of skeletal muscle. Alternatively spliced transcripts encoding distinct isoforms, which are translated through the use of a non-AUG (AUU) initiation codon, have been described for this gene. provided by RefSeq, Jul 2008 |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
"NM_011567" in other vectors (4)
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| MC209510 | Tead4 (untagged) - Mouse TEA domain family member 4 (Tead4), transcript variant 1, (10ug) | 10 ug |
$503.00
|
|
| MG219506 | Tead4 (tGFP-tagged) - Mouse TEA domain family member 4 (Tead4) transcript variant 1, (10ug) | 10 ug |
$657.00
|
|
| MR219506L3 | Lenti ORF clone of Tead4 (Myc-DDK-tagged) - Mouse TEA domain family member 4 (Tead4), transcript variant 1 | 10 ug |
$757.00
|
|
| MR219506L4 | Lenti ORF clone of Tead4 (mGFP-tagged) - Mouse TEA domain family member 4 (Tead4), transcript variant 1 | 10 ug |
$757.00
|
|
Citations
Platr4 is an early embryonic lncRNA that exerts its function downstream on cardiogenic mesodermal lineage commitment
Hazra, Brine, Garcia et al
Dev Cell (2022) 57 (21), 2450-2468.e7 DOI: 10.1016/j.devcel.2022.10.002
Hazra, Brine, Garcia et al
Dev Cell (2022) 57 (21), 2450-2468.e7 DOI: 10.1016/j.devcel.2022.10.002
Cited by 17
AI Summary: OriGene products contributed to this study by providing the Tead4 (Cat# MR219506) and Ctgf (Cat# MC200503) mouse gene clones, which were used to investigate the molecular mechanisms by which the lncRNA Platr4 regulates cardiac mesoderm lineage specification.
Snippet: gPCR_Platr4-R2: AGAGACCACCTCCCTCTGCT This paper NA Recombinant DNA Tead4 (NM_011567) Mouse Tagged ORF Clone Origene Cat# MR219506 Ctgf (BC006783) Mouse Untagged Clone Origene Cat#: MC200503
HIF1α-AS1 is a DNA:DNA:RNA triplex-forming lncRNA interacting with the HUSH complex
Leisegang, Bains, Seredinski et al
Nat Commun (2022) 13 (1), 6563 DOI: 10.1038/s41467-022-34252-2
Leisegang, Bains, Seredinski et al
Nat Commun (2022) 13 (1), 6563 DOI: 10.1038/s41467-022-34252-2
Cited by 49
AI Summary: OriGene products contributed to this study by providing the pCMV6-MPP8-MYC-DDK plasmid (Cat# RC202562L3), the Recombinant DNA Tead4 Mouse Tagged ORF Clone (Cat# MR219506), and the Ctgf Mouse Untagged Clone (Cat# MC200503), which were used for gene expression and functional analyses related to the role of HIF1α-AS1 in DNA:DNA:RNA triplex formation and gene regulation.
Snippet: … pCMV6-MPP8-MYC-DDK was obtained from Origene (#RC202562L3). The plasmid pcDNA3.1 + HIF1α-AS1_1200 (called TFR2) included the first 1200 nt (hg19, chr14:62,161,342-62,162,541) of the genomic DNA of the HIF1α-AS1 gene and was synthes;gPCR_Platr4-R2: AGAGACCACCTCCCTCTGCT This paper NA Recombinant DNA Tead4 (NM_011567) Mouse Tagged ORF Clone Origene Cat# MR219506 Ctgf (BC006783) Mouse Untagged Clone Origene Cat#: MC200503
Glycolysis-Independent Glucose Metabolism Distinguishes TE from ICM Fate during Mammalian Embryogenesis
Chi, Sharpley, Nagaraj et al
Dev. Cell (2020) 53 (1), 9-26.e4 DOI: 10.1016/j.devcel.2020.02.015
Chi, Sharpley, Nagaraj et al
Dev. Cell (2020) 53 (1), 9-26.e4 DOI: 10.1016/j.devcel.2020.02.015
Cited by 197
Glucose metabolism distinguishes TE from ICM fate during mammalian embryogenesis
Chi, Sharpley, Nagaraj et al
bioRxiv (2019)
Chi, Sharpley, Nagaraj et al
bioRxiv (2019)
Showing 1-5 of 5 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
