OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Tead4 (NM_011567) Mouse Untagged Clone

Be the first to review this product
SKU
MC209510
Tead4 (untagged) - Mouse TEA domain family member 4 (Tead4), transcript variant 1, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA355606 Tead4 Antibody - middle region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Tead4 or NM_011567"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Tead4
Synonyms Etfr; ETFR-; ETFR-2; Etfr2; FR-19; Rtef; Rtef1; Tcf13r; Tcf13r1; TEAD-; TEAD-4; Tef; TEF-3; Tef3; Tefr; Tefr1; Tefr1a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209510 representing NM_011567
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATTACCTCCAACGAGTGGAGCTCTCCCGACTCCCCCGAGGGGAGCAGCATCTCTGGGGGCAGCCAGGCAC
TGGACAAGCCCATCGACAATGATGCAGAGGGTGTATGGAGCCCCGAAATTGAGCGAAGCTTCCAGGAGGC
CCTGGCCATCTACCCACCCTGCGGCCGCCGCAAAATTATCCTGACGGAGGAAGGCAAGATGTATGGTCGG
AATGAGCTGATCGCACGCCATATCAAGCTCAGGACAGGGAAGACGCGCACAAGGAAGCAGGTCTCCAGCC
ACATCCAGGTGCTTGCCCGTCGAAAAGCCCGGGAGATCCAGGCCAAACTCAAGGACCAGGCAGCTAAGAA
CAAGGCCCTGCAGAGCATGGCTGCCATGTCGTCCGCACAGATCGTCTCGGCCACAGCCTTCCACAGTAAA
ATGGCTCTTGCCCGGGGCCCTGGCTACCCAGCAATCTCAGGGTTTTGGCAAGGAGCTTTGCCAGGCCAAC
CTGGAACATCCCACGATGTGAAACCTTTCTCTCAAAACACCTACCCTGTCCAGCCTCCGCTGCCTCTGCC
AGGCTTTGAGTCTCCTGCAGGGCCCACCCCCTCACCCTCCGCACCGCTCGCTCCTCCGTGGCAAGGCCGC
AGCATAGCTAGCTCCAAGCTCTGGATGTTGGAGTTCTCGGCTTTCCTGGAGCGCCAGCAAGATCCCGACA
CATACAACAAACACCTGTTTGTGCACATCAGCCAGTCAAGCCCAAGCTACAGTGACCCCTACCTCGAAAC
TGTGGACATCCGCCAAATCTATGACAAGTTCCCAGAGAAGAAGGGAGGCCTCAAGGAGCTATTTGAACGG
GGGCCCTCTAATGCCTTCTTCCTTGTGAAGTTCTGGGCAGACCTCAATACCAACATCGATGACGAGGGCA
GCGCCTTCTATGGGGTCTCCAGCCAGTACGAGAGCCCGGAGAACATGATTATCACCTGCTCTACGAAGGT
CTGCTCATTTGGCAAGCAAGTGGTGGAGAAAGTTGAGACGGAGTATGCCCGCTATGAGAATGGCCACTAT
TTGTACCGCATCCACCGGTCCCCTCTCTGTGAGTACATGATCAACTTTATCCACAAGCTGAAACACTTAC
CCGAGAAGTACATGATGAACAGTGTGCTGGAGAACTTCACCATCCTGCAGGTGGTCACCAACCGAGACAC
ACAGGAGACCTTGCTGTGTATTGCATATGTCTTCGAAGTTTCAGCCAGCGAGCATGGGGCTCAGCACCAC
ATCTACCGACTTGTGAAAGAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_011567
Insert Size 1284 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_011567.2, NP_035697.3
RefSeq Size 3076 bp
RefSeq ORF 1284 bp
Locus ID 21679
UniProt ID Q62296
Cytogenetics 6 62.92 cM
Summary This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is preferentially expressed in the skeletal muscle, and binds to the M-CAT regulatory element found in promoters of muscle-specific genes to direct their gene expression. This factor may play a role in the embryonic development of skeletal muscle. Alternatively spliced transcripts encoding distinct isoforms, which are translated through the use of a non-AUG (AUU) initiation codon, have been described for this gene. provided by RefSeq, Jul 2008
Transcript Variant: This variant (1) encodes the longer isoform (a, also known as ETFR-2a), and initiates translation from a non-AUG (AUU) codon.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_011567" in other vectors (4)
SKU Description Size Price
MG219506 Tead4 (tGFP-tagged) - Mouse TEA domain family member 4 (Tead4) transcript variant 1, (10ug) 10 ug
$657.00
MR219506 Tead4 (Myc-DDK-tagged) - Mouse TEA domain family member 4 (Tead4), transcript variant 1 10 ug
$289.00 $457.00
MR219506L3 Lenti ORF clone of Tead4 (Myc-DDK-tagged) - Mouse TEA domain family member 4 (Tead4), transcript variant 1 10 ug
$757.00
MR219506L4 Lenti ORF clone of Tead4 (mGFP-tagged) - Mouse TEA domain family member 4 (Tead4), transcript variant 1 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products