Chst3 (NM_016803) Mouse Tagged ORF Clone
- TrueORF®
SKU
MR207541
Chst3 (Myc-DDK-tagged) - Mouse carbohydrate (chondroitin 6/keratan) sulfotransferase 3 (Chst3)
$289.00
$457.00
In Stock*
Specifications
| Product Data | |
| Type | Mouse Tagged ORF Clone |
|---|---|
| Target Symbol | Chst3 |
| Synonyms | C6ST; C6ST-1; GST-0 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data | |
| Restriction Sites |
SgfI-MluI Cloning Scheme for this gene
|
Plasmid Map
|
| ACCN | NM_016803 |
| ORF Size | 1416 bp |
| OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
| Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_016803.2, NP_058083.1 |
| RefSeq Size | 6129 bp |
| RefSeq ORF | 1437 bp |
| Locus ID | 53374 |
| UniProt ID | O88199 |
| Cytogenetics | 10 B4 |
| MW | 54 kDa |
| Summary | Sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the transfer of sulfate to position 6 of the N-acetylgalactosamine (GalNAc) residue of chondroitin. Chondroitin sulfate constitutes the predominant proteoglycan present in cartilage and is distributed on the surfaces of many cells and extracellular matrices. Can also sulfate Gal residues of keratan sulfate, another glycosaminoglycan, and the Gal residues in sialyl N-acetyllactosamine (sialyl LacNAc) oligosaccharides. May play a role in the maintenance of naive T-lymphocytes in the spleen.UniProtKB/Swiss-Prot Function |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
"NM_016803" in other vectors (4)
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| MC205469 | Chst3 (untagged) - Mouse carbohydrate (chondroitin 6/keratan) sulfotransferase 3 (Chst3), (10ug) | 10 ug |
$457.00
|
|
| MG207541 | Chst3 (tGFP-tagged) - Mouse carbohydrate (chondroitin 6/keratan) sulfotransferase 3 (Chst3) | 10 ug |
$657.00
|
|
| MR207541L3 | Lenti ORF clone of Chst3 (Myc-DDK-tagged) - Mouse carbohydrate (chondroitin 6/keratan) sulfotransferase 3 (Chst3) | 10 ug |
$757.00
|
|
| MR207541L4 | Lenti ORF clone of Chst3 (mGFP-tagged) - Mouse carbohydrate (chondroitin 6/keratan) sulfotransferase 3 (Chst3) | 10 ug |
$757.00
|
|
Citations
Chondroitin 6-sulphate is required for neuroplasticity and memory in ageing
Yang, Gigout, Molinaro et al
Mol Psychiatry (2021)
Yang, Gigout, Molinaro et al
Mol Psychiatry (2021)
Cited by 70
AI Summary: In this study, the OriGene plasmid MR207541 was used as the source of the mouse chst3 gene to construct an AAV vector for restoring chondroitin 6-sulfate levels and investigating their role in neuroplasticity and memory in aged mice.
Snippet: The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5′ GGAATTCATAGGGCGGCCGGGAA 3′ and 5′ AGCGCTGGCCGGCCGTTTAAAC 3′ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593) between the AfeI (NEB, R0652) and EcoRI (NEB, R0101) sites to substitute the Cre recombinase gene. …
Restoring the pattern of perineuronal net sulphation corrects age-related memory loss
Fawcett, Gigout, Molinari et al
bioRxiv (2020)
Fawcett, Gigout, Molinari et al
bioRxiv (2020)
Cited by 6
Restoring the pattern of proteoglycan sulphation in perineuronal nets corrects age-related memory loss
Yang, Gigout, Molinaro et al
biorxiv.org (2020)
Yang, Gigout, Molinaro et al
biorxiv.org (2020)
Snippet: The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5' GGAATTCATAGGGCGGCC GGGAA 3' and 5' AGCGCTGGCCGGCCGTTTAAAC 3' and was cloned into plasmid AAV-PGK;- The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5' GGAATTCATAGGGCGGCC GGGAA 3' and 5' AGCGCTGGCCGGCCGTTTAAAC 3' and was cloned into plasmid AAV-PGK
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
