Fth1 (NM_010239) Mouse Tagged ORF Clone
$450.00
In Stock*
Specifications
| Product Data | |
| Type | Mouse Tagged ORF Clone |
|---|---|
| Target Symbol | Fth1 |
| Synonyms | FHC; Fth; HFt; MFH |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data | |
| Restriction Sites |
SgfI-MluI Cloning Scheme for this gene
|
Plasmid Map
|
| ACCN | NM_010239 |
| ORF Size | 546 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
| Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_010239.2 |
| RefSeq Size | 942 bp |
| RefSeq ORF | 549 bp |
| Locus ID | 14319 |
| UniProt ID | P09528 |
| Cytogenetics | 19 6.23 cM |
| MW | 21.1 kDa |
| Summary | Stores iron in a soluble, non-toxic, readily available form. Important for iron homeostasis. Has ferroxidase activity. Iron is taken up in the ferrous form and deposited as ferric hydroxides after oxidation. Also plays a role in delivery of iron to cells. Mediates iron uptake in capsule cells of the developing kidney.UniProtKB/Swiss-Prot Function |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
"NM_010239" in other vectors (4)
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| MC200868 | Fth1 (untagged) - Mouse ferritin heavy chain 1 (Fth1), (10ug) | 10 ug |
$450.00
|
|
| MG201645 | Fth1 (tGFP-tagged) - Mouse ferritin heavy chain 1 (Fth1) | 10 ug |
$650.00
|
|
| MR201645L3 | Lenti ORF clone of Fth1 (Myc-DDK-tagged) - Mouse ferritin heavy chain 1 (Fth1) | 10 ug |
$750.00
|
|
| MR201645L4 | Lenti ORF clone of Fth1 (mGFP-tagged) - Mouse ferritin heavy chain 1 (Fth1) | 10 ug |
$750.00
|
|
Citations
Determination of oligomerization state of Drp1 protein in living cells at nanomolar concentrations
Kwapiszewska, Kalwarczyk, Michalska et al
Sci Rep (2019) 9 (1), 5906 DOI: 10.1038/s41598-019-42418-0
Kwapiszewska, Kalwarczyk, Michalska et al
Sci Rep (2019) 9 (1), 5906 DOI: 10.1038/s41598-019-42418-0
AI Summary: OriGene contributed the cDNA for Drp1 isoform 1 (product: RG221708), which was used as the template for generating constructs to study Drp1 oligomerization in living cells.
Snippet: will be crucial for understanding and tackling pathological changes in cellular metabolism. Methods Plasmid preparation The cDNA coding for isoform 1 (transcript variant 1) of Drp1 was obtained from Origene (RG221708). The cDNA was amplified by PCR using primers (for: AGCTTCGAATTCTATGGAGGCGCTAATTCCTGTCATAAACAAGCTC, rev: CTGAAATCCGGGAGACTCATCTTTGGTGAGGATCCACCGGA) and subcloned to the pmEGFP-C1 vec
Insight into the fission mechanism by quantitative characterization of Drp1 protein distribution in the living cell
Michalska, Kwapiszewska, Szczepanowska et al
Sci Rep (2018) 8 (1), 8122 DOI: 10.1038/s41598-018-26578-z
Michalska, Kwapiszewska, Szczepanowska et al
Sci Rep (2018) 8 (1), 8122 DOI: 10.1038/s41598-018-26578-z
AI Summary: OriGene’s Drp1 cDNA (product RG221708) was used as the template for gene editing and expression studies, enabling the quantitative analysis of Drp1 distribution and oligomeric states in living cells described in the paper.
Snippet: gulation of mitochondrial fission by Drp1. Methods Plasmids and gene editing The cDNA encoding isoform 1 (transcript variant 1, NP_036192, 736 aa, Supplementary Table S2) of Drp1 was purchased from OriGene (RG221708). … gulation of mitochondrial fission by Drp1. Methods Plasmids and gene editing The cDNA encoding isoform 1 (transcript variant 1, NP_036192, 736 aa, Supplementary Table S2) of Drp1 was purchased from OriGene (RG221708). …
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
