OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Sgk3 (BC018363) Mouse Untagged Clone

Be the first to review this product
SKU
MC218544
Sgk3 (untagged) - Mouse serum/glucocorticoid regulated kinase 3 (cDNA clone MGC:19373 IMAGE:2631682), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA363187 SGK3 Antibody - N-terminal region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Sgk3 or BC018363"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Sgk3
Synonyms 2510015P22Rik; A330005P07Rik; Cisk; fy; fz
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC018363
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTCTGAAGATTCCTGCCAAGAGAATATTTGGTGATAATTTTGATCCAGATTTTATTAAACAAAGAA
GAGCAGGATTGAATGAGTTCATTCAGAACTTGGTCAGATATCCAGAGCTTTACAACCATCCAGATGTCCG
AGCATTCCTTCAAATGGACAGCCCAAGACATCAGTCAGATCCATCTGAAGATGAGGATGAAAGAAGTACT
TCGAAGCCACATTCTACCTCACGGAACATCAACCTGGGACCAACTGGAAATCCTCATGCTAAACCAACTG
ACTTCGATTTTTTAAAAGTTATTGGAAAGGGCAGCTTTGGCAAGGTTCTTCTTGCAAAACGGAAACTGGA
TGGAAAATTTTATGCTGTCAAAGTGTTACAGAAAAAAATAGTTCTCAACAGAAAAGAGCAAAAACATATT
ATGGCTGAACGCAATGTGCTCTTGAAAAATGTGAAGCACCCATTTTTGGTTGGATTGCACTATTCTTTCC
AAACAACTGAAAAGCTTTATTTTGTTCTGGATTTTGTTAATGGAGGGGAGCTCTTCTTTCACCTCCAAAG
GGAAAGGTCTTTTCCTGAACCCAGAGCGAGGTTTTATGCCGCGGAGATCGCCAGTGCCTTGGGCTACCTG
CACTCCATCAAAATAGTGTACAGAGACTTGAAGCCAGAAAATATTCTTTTGGATTCAATGGGACATGTTG
TCTTAACGGATTTTGGACTTTGCAAAGAAGGAATCGCTATTTCTGATACCACCACAACTTTTTGTGGTAC
ACCAGAGTACCTTGCACCTGAAGTAATCAGAAAACAGCCCTATGACAACACTGTGGACTGGTGGTGCCTG
GGCGCTGTTCTGTATGAGATGCTGTACGGGCTGCCTCCTTTTTACTGCCGAGATGTTGCTGAAATGTATG
ACAATATTCTTCACAAGCCCTTAAACTTGAGACCAGGAGTGAGTCTCACCGCCTGGTCCATTCTGGAAGA
ACTTCTAGAAAAAAACAGACAAAATCGACTTGGTGCCAAAGAAGACTTTCTTGAAATCCAGAATCATCCT
TTTTTTGAGTCACTCAGCTGGACTGACCTCGTACAAAAAAAGATTCCACCTCCATTTAACCCTAATGTGG
CTGGACCAGATGATATCAGAAACTTTGATGCCGTCTTCACTGAAGAAACGGTTCCCTATTCAGTGTGTGT
GTCTTCTGACTATTCCATCGTGAATGCCAGTGTTCTGGAGGCAGATGATGCATTTGTTGGTTTTTCTTAC
GCCCCTCCTTCGGAAGACTTATTTTTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN BC018363
Insert Size 1290 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC018363, AAH18363
RefSeq Size 2494 bp
RefSeq ORF 1289 bp
Locus ID 170755
Cytogenetics 1 2.08 cM
Summary Serine/threonine-protein kinase which is involved in the regulation of a wide variety of ion channels, membrane transporters, cell growth, proliferation, survival and migration. Up-regulates Na(+) channels: SCNN1A/ENAC and SCN5A, K(+) channels: KCNA3/KV1.3, KCNE1, KCNQ1 and KCNH2/HERG, epithelial Ca(2+) channels: TRPV5 and TRPV6, chloride channel: BSND, creatine transporter: SLC6A8, Na(+)/dicarboxylate cotransporter: SLC13A2/NADC1, Na(+)-dependent phosphate cotransporter: SLC34A2/NAPI-2B, amino acid transporters: SLC1A5/ASCT2 and SLC6A19, glutamate transporters: SLC1A3/EAAT1, SLC1A6/EAAT4 and SLC1A7/EAAT5, glutamate receptors: GRIA1/GLUR1 and GRIK2/GLUR6, Na(+)/H(+) exchanger: SLC9A3/NHE3, and the Na(+)/K(+) ATPase. Plays a role in the regulation of renal tubular phosphate transport and bone density. Phosphorylates NEDD4L and GSK3B. Positively regulates ER transcription activity through phosphorylation of FLII. Negatively regulates the function of ITCH/AIP4 via its phosphorylation and thereby prevents CXCR4 from being efficiently sorted to lysosomes.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"BC018363" in other vectors (4)
SKU Description Size Price
MG206839 Sgk3 (tGFP-tagged) - Mouse serum/glucocorticoid regulated kinase 3 (cDNA clone MGC:19373 IMAGE:2631682) 10 ug
$657.00
MR206839 Sgk3 (Myc-DDK-tagged) - Mouse serum/glucocorticoid regulated kinase 3 (cDNA clone MGC:19373 IMAGE:2631682) 10 ug
$289.00 $457.00
MR206839L3 Lenti ORF clone of Sgk3 (Myc-DDK-tagged) - Mouse serum/glucocorticoid regulated kinase 3 (cDNA clone MGC:19373 IMAGE:2631682) 10 ug
$757.00
MR206839L4 Lenti ORF clone of Sgk3 (mGFP-tagged) - Mouse serum/glucocorticoid regulated kinase 3 (cDNA clone MGC:19373 IMAGE:2631682) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products