OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Shc1 (NM_011368) Mouse Untagged Clone

Be the first to review this product
SKU
MC216286
Shc1 (untagged) - Mouse src homology 2 domain-containing transforming protein C1 (Shc1), transcript variant 2, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free DDK
AAV Particle:
DDK
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Shc1 or NM_011368"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Shc1
Synonyms p66; p66shc; Shc; ShcA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC216286 representing NM_011368
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGT
GGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTCATGGG
ACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGAGCCCTTGAC
TTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAG
GGGCGACAAGGAGGAGAAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTT
TGCTGGAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAG
ATCATTGCCAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTATG
TTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGC
TCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCG
AAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGC
CCCCTGACCATCAGTACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAG
GCTTCGGGAAGGGGCTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTG
CCTATAGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGCCCAG
GCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGG
TGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTT
GAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCT
GGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCG
AGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTG
CTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCT
ACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCG
GAAAGTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_011368
Insert Size 1410 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_011368.5, NP_035498.2
RefSeq Size 3171 bp
RefSeq ORF 1410 bp
Locus ID 20416
UniProt ID P98083
Cytogenetics 3 39.11 cM
Summary Signaling adapter that couples activated growth factor receptors to signaling pathways. Participates in signaling downstream of the angiopoietin receptor TEK/TIE2, and plays a role in the regulation of endothelial cell migration and sprouting angiogenesis (By similarity). Participates in a signaling cascade initiated by activated KIT and KITLG/SCF. Isoform p47Shc and isoform p52Shc, once phosphorylated, couple activated receptor kinases to Ras via the recruitment of the GRB2/SOS complex and are implicated in the cytoplasmic propagation of mitogenic signals. Isoform p47Shc and isoform p52 may thus function as initiators of the Ras signaling cascade in various non-neuronal systems. Isoform p66Shc does not mediate Ras activation, but is involved in signal transduction pathways that regulate the cellular response to oxidative stress and life span. Isoform p66Shc acts as a downstream target of the tumor suppressor p53 and is indispensable for the ability of stress-activated p53 to induce elevation of intracellular oxidants, cytochrome c release and apoptosis. The expression of isoform p66Shc has been correlated with life span.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) represents use of an alternate promoter and 5' UTR and uses a downstream start codon, compared to variant 1. The resulting isoform (b) has a shorter N-terminus, compared to isoform a.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_011368" in other vectors (3)
SKU Description Size Price
MR207498 Shc1 (Myc-DDK-tagged) - Mouse src homology 2 domain-containing transforming protein C1 (Shc1), transcript variant 2 10 ug
$289.00 $457.00
MR207498L3 Lenti ORF clone of Shc1 (Myc-DDK-tagged) - Mouse src homology 2 domain-containing transforming protein C1 (Shc1), transcript variant 2 10 ug
$757.00
MR207498L4 Lenti ORF clone of Shc1 (mGFP-tagged) - Mouse src homology 2 domain-containing transforming protein C1 (Shc1), transcript variant 2 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products