OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Dmap1 (NM_023178) Mouse Untagged Clone

Be the first to review this product
SKU
MC216224
Dmap1 (untagged) - Mouse DNA methyltransferase 1-associated protein 1 (Dmap1), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $503.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Dmap1 or NM_023178"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Dmap1
Synonyms 1500016M21Rik; Dmtap1; DNMAP1; DNMTAP1; mKIAA1425
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC216224 representing NM_023178
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTACGGGCGCAGATGTACGAGACATTCTAGAACTCGGGGGTCCAGAGGGAGATGCCGCCTCTGGGA
CCATCAGCAAAAAGGATATTATCAACCCGGACAAGAAAAAGTCCAAGAAGTCCTCAGAGACGCTGACCTT
CAAGAGGCCTGAGGGCATGCATCGGGAGGTCTATGCTTTGCTTTACTCTGACAAAAAGGATGCACCCCCA
CTGCTGCCCAGTGACACTGGTCAGGGGTATCGGACAGTGAAGGCGAAACTGGGGTCCAAGAAGGTTCGCC
CTTGGAAATGGATGCCTTTTACTAACCCAGCTCGAAAGGACGGCGCTATGTTTTTCCACTGGCGACGAGC
GGCGGAGGAGGGCAAGGACTACCCTTTTGCCAGGTTCAATAAGACGGTGCAGGTGCCCGTGTACTCAGAG
CAGGAGTACCAACTCTACCTTCATGATGACGCATGGACTAAGGCAGAGACTGACCACCTATTTGACCTCA
GCCGCCGATTTGATCTGCGCTTCGTAGTTATTCACGATCGGTATGACCACCAGCAGTTCAAGAAGCGTTC
TGTGGAGGACCTGAAAGAGAGGTACTACCACATTTGTGCCAAGCTTGCCAACGTGAGGGCTGTGCCAGGC
ACAGATCTCAAGATACCAGTGTTTGATGCTGGGCATGAGAGACGGCGGAAGGAACAGCTAGAGCGGCTTT
ACAACCGAACCCCAGAGCAGGTGGCAGAGGAGGAGTACCTCCTACAGGAGCTGCGTAAGATTGAGGCCCG
GAAAAAAGAGCGGGAGAAGCGCAGCCAAGACCTGCAGAAGCTGATTACAGCAGCAGACACCACTGCAGAG
CAGCGGCGCACGGAACGCAAGGCTCCCAAGAAGAAGCTACCCCAAAAGAAGGAGGCTGAGAAGCCGGCTG
TCCCTGAGACTGCAGGCATCAAGTTTCCAGATTTTAAGTCGGCAGGTGTCACGCTACGGAGCCAGCGGAT
GAAGCTACCCAGCTCTGTGGGTCAGAAGAAGATCAAGGCGCTGGAACAGATGCTGCTGGAACTTGGTGTG
GAGCTGAGCCCTACCCCCACAGAGGAGCTGGTGCATATGTTCAATGAGTTGCGGAGCGACCTGGTGTTAC
TCTACGAGCTCAAGCAGGCCTGTGCCAACTGTGAATATGAGCTACAGATGCTGCGGCACCGGCACGAGGC
CCTGGCTCGGGCAGGAGTGCTGGGGGCCCCTGCCGCAGCAGCAGTGGGACCAACCCCGGCTTCTGCTGAG
CCAACAGTGTCTGAATCTGGACTTGGTCTGGACCCCACCAAGGATACCATCATTGATGTCGTGGGTGCAC
CCCTCACACCCAATTCGCGGAAACGACGGGAATCAGCCTCCAGCTCATCTTCTGTGAAGAAAGCCAAGAA
ACCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_023178
Insert Size 1407 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_023178.2, NP_075667.1
RefSeq Size 1543 bp
RefSeq ORF 1407 bp
Locus ID 66233
UniProt ID Q9JI44
Cytogenetics 4 D2.1
Summary Involved in transcription repression and activation. Its interaction with HDAC2 may provide a mechanism for histone deacetylation in heterochromatin following replication of DNA at late firing origins. Can also repress transcription independently of histone deacetylase activity. May specifically potentiate DAXX-mediated repression of glucocorticoid receptor-dependent transcription. Component of the NuA4 histone acetyltransferase (HAT) complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. NuA4 may also play a direct role in DNA repair when recruited to sites of DNA damage. Participates in the nuclear localization of URI1 and increases its transcriptional corepressor activity (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_023178" in other vectors (4)
SKU Description Size Price
MG207480 Dmap1 (tGFP-tagged) - Mouse DNA methyltransferase 1-associated protein 1 (Dmap1) 10 ug
$657.00
MR207480 Dmap1 (Myc-DDK-tagged) - Mouse DNA methyltransferase 1-associated protein 1 (Dmap1) 10 ug
$289.00 $457.00
MR207480L3 Lenti ORF clone of Dmap1 (Myc-DDK-tagged) - Mouse DNA methyltransferase 1-associated protein 1 (Dmap1) 10 ug
$757.00
MR207480L4 Lenti ORF clone of Dmap1 (mGFP-tagged) - Mouse DNA methyltransferase 1-associated protein 1 (Dmap1) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products