Nanos2 (NM_194064) Mouse Untagged Clone

SKU
MC214663
Nanos2 (untagged) - Mouse nanos homolog 2 (Drosophila) (Nanos2), (10ug)
  $150.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Nanos2
Synonyms nos2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC214663 representing NM_194064
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACCTACCGCCCTTTGACATGTGGAGAGACTACTTTAACCTGAGCCAGGTGGTGATGGATATAATTC
AGAGCCGGAAGCAAAGACAGGAGGGTGAGGTAGCTGAGGAGCCCAACTCCAGGCCCCAGGAGAAGAGTGA
GCAGGACCTGGAGGGCTACCCTGGATGTCTGCCTACCATATGCAACTTCTGCAAGCACAATGGGGAGTCT
CGTCACGTCTACACCTCACACCAGCTGAAGACGCCTGAAGGGGTGGTTGTGTGTCCCATCCTGAGGCACT
ATGTGTGTCCTCTATGTGGAGCCACCGGCGACCAGGCTCATACACTCAAGTATTGTCCACTCAACAGCAG
TCAGCAGTCTCTCTACCGACGCAGTGGGCGAAACTCAGCTGGTCGCAGAGTCAAGCGATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_194064
Insert Size 411 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_194064.2, NP_918953.2
RefSeq Size 1439 bp
RefSeq ORF 411 bp
Locus ID 378430
UniProt ID P60322
Cytogenetics 7 A3
Summary Plays a key role in the sexual differentiation of germ cells by promoting the male fate but suppressing the female fate. Represses the female fate pathways by suppressing meiosis, which in turn results in the promotion of the male fate. Maintains the suppression of meiosis by preventing STRA8 expression, which is required for premeiotic DNA replication, after CYP26B1 is decreased. Regulates the localization of the CCR4-NOT deadenylation complex to P-bodies and plays a role in recruiting the complex to trigger the degradation of mRNAs involved in meiosis. Required for the maintenance of the spermatogonial stem cell population. Not essential for the assembly of P-bodies but is required for the maintenance of their normal state.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_194064" in other vectors (4)
SKU Description Size Price
MG222297 Nanos2 (tGFP-tagged) - Mouse nanos homolog 2 (Drosophila) (Nanos2), (10ug) 10 ug
$350.00
MR222297 Nanos2 (Myc-DDK-tagged) - Mouse nanos homolog 2 (Drosophila) (Nanos2) 10 ug
$289.00
MR222297L3 Lenti ORF clone of Nanos2 (Myc-DDK-tagged) - Mouse nanos homolog 2 (Drosophila) (Nanos2) 10 ug
$450.00
MR222297L4 Lenti ORF clone of Nanos2 (mGFP-tagged) - Mouse nanos homolog 2 (Drosophila) (Nanos2) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products