Dtd2 (NM_029545) Mouse Untagged Clone

SKU MC214512

Dtd2 (untagged) - Mouse RIKEN cDNA 6530401N04 gene (6530401N04Rik), (10ug)

Product Data

• Type: Mouse Untagged Clone
• Target Symbol: Dtd2
• Synonyms: 4930578F06Rik; 6530401N04Rik; B830049N13Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC214512 representing NM_029545; Red=Cloning site Blue=ORF Orange=Stop codon; ; TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC; GCCGCGATCGCC; ; ATGGCGGACGGTGGTCGTGTGGCCCAGGCTCGTGCGCTCCTGCAGCAGTGCCTGCACGCTCGCCTGCAAG; TGCGCCCGGCCGATGGAGACGCCGCGGCGCAGTGGGTGGAGATTCGGAGAGGATTGGTGATCTATGTGTG; TTTCTTCAAGGGAGCTGACACAGACCTTCTCCCCAAAATGGTTAATACGCTGTTAAATGTGAAGTTAAGC; GAAACGGAAACCGGCAAGCACGTCTCCATCCTCGATCTGCCTGGCGATGTTCTGATCATCCCGCAAGCCA; CCCTCGGGGGCAGGGTGAAAGGGCGGAGCATGCAGTACCACTCTAACTCTGGAAAGGAGGAGGGCTCAGA; ACTGTACTCCCAGTTTGTGAGTCTGTGTGAAAAAGCCGTGGCCAACAACACCAAGAGTGTAGAAGCGGGG; GTTGCGGTGGCGCACGGCACGTACGGGAACAGGCAAGTGTTAAAGCTGGACACCAATGGACCCTACACGC; ACCTCATTGAGTTTTGA; ; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT; ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_029545
• Insert Size: 507 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_029545.2, NP_083821.1
• RefSeq Size: 2564 bp
• RefSeq ORF: 507 bp
• Locus ID: 328092
• UniProt ID: Q8BHA3
• Cytogenetics: 12 C1
• Summary: Deacylates mischarged D-aminoacyl-tRNAs. Probably acts by rejecting L-amino acids from its binding site rather than specific recognition of D-amino acids. Catalyzes the hydrolysis of D-tyrosyl-tRNA(Tyr), has no activity on correctly charged L-tyrosyl-tRNA(Tyr). By recycling D-aminoacyl-tRNA to D-amino acids and free tRNA molecules, this enzyme counteracts the toxicity associated with the formation of D-aminoacyl-tRNA entities in vivo and helps enforce protein L-homochirality. In contrast to DTD1, deacylates L-Ala mischarged on tRNA(Thr)(G4.U69) by alanine-tRNA ligase AARS. Can deacylate L-Ala due to a relaxed specificity for substrate chirality caused by the trans conformation of the Gly-Pro motif in the active site. Also hydrolyzes correctly charged, achiral, glycyl-tRNA(Gly) in vitro, although in vivo EEF1A1/EF-Tu may protect cognate achiral glycyl-tRNA(Gly) from DTD2-mediated deacetylation.[UniProtKB/Swiss-Prot Function]; Transcript Variant: This variant (2) lacks an exon and its 3' terminal exon extends past a splice site that is used in variant 1. This results in a novel 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) is longer and has a distinct C-terminus, compared to isoform 1.