OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mterf1b (NM_001042670) Mouse Untagged Clone

Be the first to review this product
SKU
MC212505
Gm9897 (untagged) - Mouse predicted gene 9897 (Gm9897), nuclear gene encoding mitochondrial protein, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP tGFP DDK
AAV Particle:
DDK
  $503.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Mterf1b or NM_001042670"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Mterf1b
Synonyms ENSMUSG00000053178; Gm9897
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC212505 representing NM_001042670
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATTATGGCATCAAGAAACATCTGGTGTGTGAGAAGAAACTTTCTCTTTGATTTAAGAGGCTGGATGC
TTCAGTATTCAGCAGAAGTTTTCCTCAAGTCGATTTCATTCAGGACGTTTAGTGTGGAATGCGACAGTAA
GGACAAGGAGTCTTTGGAGGAGGAGAGGGAGGACCTGCTGAGCAACTTAGTCACCATGGGCGTTGATATC
GACATGGCAAGGAGGCGACAGCCTGGAGTTTTTAACAAGGCTGTTACGAATGAGCAGGAGCTGAAGATAT
TCCTTCTGTCCAAGGGAGCTAGTGACAAAGTGATTGGTAGCATCATATCAAGATATCCACGAGCTATAAC
ACGCACTCCTGAAAGTCTTTCAAAACGGTGGGATCTGTGGAGAAAGATTATGGCATCAGACCTTGAAATT
GTAAATATTTTGGAGCGTTCTCCTGAATCCTTTTTTCGATCTAATAACAATCTAAACTTAGAGAATAATA
TAAAGTTCCTTTGCTCTGTTGGATTGACTCATAAATGCCTCTGCAGACTGTTGACCAATGCTCCCAGAAC
CTTCTCCAACAGTCTGAATTTGAATAAGCAAATGGTTGAATTTTTGCAGGAGACTGGTATGTCCTTAGGT
CACAATGATCCCAGAGATTTTGTCAGGAAGATAATTTCTAAAAACCCTTCCATCTTAATTCAGAGCACCA
AGCGTGTAAAAACTAACATTGAATTTTTACAATCAACTTTCAACTTGAACAAACAGGACCTGCTGCTTCT
GATATGTGGCCCAGGAGCTAGAATCTTAGACCTTTCCAATGACTGTACCAAAAAAAATTACACAAACATA
AGAGAGAGGCTGCTTTCTCTTGGGTGCAGTGAGGAGGAGGTACAGAGGTTTGTCCTAAGCTATCTGAATA
TGGTCTTCTTGTCAGAAAAAAAGTTTAATGATAAAATAGACTGCCTTATAGAAGAAAAAATCAGTGCTTC
ACAAATAATTGAAAATCCGAGGATTTTAGACTCCAGCATAAATACTTTAAAAACTCGCATCCGAGAGCTG
TCCCATGCTGGGTATGACTTGAGCACATCCAGCATTGCTCTGCTGTCCTGGAGTCAGAGAAGATATGAAG
CTAAACTGAAGAGATTATGTGGATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001042670
Insert Size 1146 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001042670.1, NP_001036135.2
RefSeq Size 1368 bp
RefSeq ORF 1146 bp
Locus ID 208595
UniProt ID B9EJ57
Cytogenetics 5
Summary Transcription termination factor. Binds to a 28 bp region within the tRNA(Leu(uur)) gene at a position immediately adjacent to and downstream of the 16S rRNA gene; this region comprises a tridecamer sequence critical for directing accurate termination. Binds DNA along the major grove and promotes DNA bending and partial unwinding. Promotes base flipping. Transcription termination activity appears to be polarized with highest specificity for transcripts initiated on the light strand.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001042670" in other vectors (5)
SKU Description Size Price
MG205911 Gm9897 (tGFP-tagged) - Mouse mitochondrial transcription termination factor-like (LOC208595), nuclear gene encoding mitochondrial protein 10 ug
$657.00
MG219778 Gm9897 (tGFP-tagged) - Mouse predicted gene 9897 (Gm9897) nuclear gene encoding mitochondrial protein, (10ug) 10 ug
$657.00
MR219778 Gm9897 (Myc-DDK-tagged) - Mouse predicted gene 9897 (Gm9897), nuclear gene encoding mitochondrial protein 10 ug
$289.00 $457.00
MR219778L3 Lenti ORF clone of Gm9897 (Myc-DDK-tagged) - Mouse predicted gene 9897 (Gm9897), nuclear gene encoding mitochondrial protein 10 ug
$757.00
MR219778L4 Lenti ORF clone of Gm9897 (mGFP-tagged) - Mouse predicted gene 9897 (Gm9897), nuclear gene encoding mitochondrial protein 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products