Khdrbs2 (NM_133235) Mouse Untagged Clone

SKU
MC212336
Khdrbs2 (untagged) - Mouse KH domain containing, RNA binding, signal transduction associated 2 (Khdrbs2), (10ug)
  $503.00
4 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Khdrbs2
Synonyms 6330586C16Rik; mSLM-1; Slim1; SLM; Slm-1; Slm1; Tg(LRRK2*R1441G)135Cjli; TG-RP135
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC212336 representing NM_133235
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGAGAAGAGAAATACTTGCCTGAGCTGATGGCAGAGAAGGATAGCCTGGATCCATCTTTTGTGCACG
CGTCGCGCCTTCTGGCGGAAGAAATTGAGAAATTTCAAGGTTCAGATGGGAAAAAGGAAGATGAAGAAAA
GAAATATCTCGATGTCATCAGCAACAAAAACATAAAGCTCTCTGAAAGAGTATTGATTCCTGTGAAACAG
TATCCAAAGTTCAATTTTGTGGGGAAATTGCTTGGACCAAGAGGAAACTCCTTGAAGAGGCTACAAGAAG
AAACGGGTGCTAAAATGTCTATCCTGGGCAAAGGGTCCATGCGAGATAAGACAAAGGAAGAAGAGCTGAG
GAAGAGTGGGGAGGCCAAGTATGCCCACCTGAGTGATGAGCTGCATGTATTAATTGAAGTGTTTGCTCCA
CCCGGGGAAGCTTATTCACGGATGAGTCATGCCTTGGAAGAGATTAAAAAATTCCTGGTTCCTGACTACA
ATGATGAAATTCGTCAAGAGCAACTCCGGGAGTTGTCTTACTTGAATGGCTCAGAAGAGTCTGGCCGGGG
CCGAGGTATTAGAGGCAGAGGGATCAGAATAACTCCCACAGCTCCATCAAGGGGCCGTGGCGGTGCTGTT
CCACCACCACCACCACCTGGACGAGGTGTGCTTACCCCTCGGGGGACCACTGTGACCCGTGGAGCTCTTC
CAGTGCCCCCAATAGCAAGAGGTGTCCCCACACCTCGAGCCCGGGGGACGGCAGCAGTACCAGGATACAG
AGCACCCCCACCTCCAGCTCATGATGCTTATGAAGAATATGGGTATGATGATGGCTATGGGGGTGAATAT
GATGACCAGACCTATGAGGCTTATGATAATAGCTACGTGACCCCAACACAAAGTGTGCCTGAATACTATG
ACTACGGTCATGGAGTAAACGAGGATGCCTACGACAGCTACGCACCAGAAGAATGGGCCACAACTCGCTC
CAGCCTGAAGGCACCACCACCAAGGTCAGCCAGAGGGGGATACAGGGAGCACCCCTATGGTAGATATTGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII |
ACCN NM_133235
Insert Size 1050 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_133235.2, NP_573498.1
RefSeq Size 1363 bp
RefSeq ORF 1050 bp
Locus ID 170771
UniProt ID Q9WU01
Cytogenetics 1 B
Summary The protein encoded by this gene is similar to the src associated in mitosis, 68 kDa protein, which is an RNA-binding protein and a substrate for Src-family tyrosine kinases during mitosis. This protein has a KH RNA-binding motif and proline-rich motifs which may be SH2 and SH3 domain binding sites. A similar rat protein is an RNA-binding protein which is tyrosine phosphorylated by Src during mitosis. These studies also suggest that the rat protein may function as an adaptor protein for Src by binding the SH2 and SH3 domains of various other proteins. provided by RefSeq, Jul 2008
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_133235" in other vectors (4)
SKU Description Size Price
MG215998 Khdrbs2 (tGFP-tagged) - Mouse KH domain containing RNA binding signal transduction associated 2 (Khdrbs2), (10ug) 10 ug
$657.00
MR215998 Khdrbs2 (Myc-DDK-tagged) - Mouse KH domain containing, RNA binding, signal transduction associated 2 (Khdrbs2) 10 ug
$289.00 $457.00
MR215998L3 Lenti ORF clone of Khdrbs2 (Myc-DDK-tagged) - Mouse KH domain containing, RNA binding, signal transduction associated 2 (Khdrbs2) 10 ug
$757.00
MR215998L4 Lenti ORF clone of Khdrbs2 (mGFP-tagged) - Mouse KH domain containing, RNA binding, signal transduction associated 2 (Khdrbs2) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products