Slc14a1 (NM_028122) Mouse Untagged Clone

SKU
MC212166
Slc14a1 (untagged) - Mouse solute carrier family 14 (urea transporter), member 1 (Slc14a1), transcript variant 2, (10ug)
  $503.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Slc14a1
Synonyms 2610507K20Rik; 3021401A05Rik; UT-B; Utb1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC212166 representing NM_028122
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAGATAGTCCCACCATGGTTAAAGTAGACCGGGGTGAAAACCAGATTTTATCATGCCGCGGGAGAA
GGTGTGGCTTCAAAGTACTTGGCTACGTCACGGGTGACATGAAGGAATTCGCCAACTGGCTGAAAGACAA
ACCCGTGGTGCTCCAGTTCATGGACTGGATACTTCGTGGCATATCCCAGGTGGTGTTTGTCAGCAACCCC
ATCAGTGGAATCCTGATTCTGGTGGGACTTCTGGTCCAGAACCCCTGGTGGGCTCTCTGTGGCTGTGTAG
GAACTGTGGTCTCCACTCTGACAGCCCTCTTGCTTAGCCAAGACAGATCGGCGATAGCAGCGGGGCTCCA
AGGTTACAATGCCACCCTGGTAGGCATCCTCATGGCTGTCTTCTCAAACAAGGGCGACTATTTCTGGTGG
CTGATATTCCCTGTATCTGCTATGTCTATGACTTGCCCGGTTTTCTCGAGCGCGTTGAGCTCCGTGCTCA
GCAAGTGGGACCTGCCCGTCTTCACTCTCCCTTTCAACATGGCGTTGTCGATGTACCTGTCAGCCACAGG
ACACTACAATACGTTTTTCCCAAGTAAACTCTTCACACCTGTCAGCTCCGTGCCCAACATCACGTGGTCT
GAGCTCAGCGCCCTGGAGCTATTGAAGTCTCTTCCGGTGGGAGTCGGTCAGATATATGGCTGTGACAACC
CGTGGACAGGCGGCATTTTCCTATGTGCTATCCTGCTCTCCTCCCCACTCATGTGCCTGCACGCTGCTAT
TGGATCGTTGCTGGGTGTCATCGCGGGACTCAGTCTTGCAGCTCCATTTGAAGACATCTACTTTGGGCTC
TGGGGTTTCAACAGCTCTCTGGCCTGCATTGCAATTGGAGGGATGTTCATGGCACTCACCTGGCAGACCC
ACCTCCTGGCTCTTGCCTGTGCCCTGTTCACTGCCTACTTCGGAGCCTGTATGGCACACCTGATGGCTGT
GGTTCACCTGCCAGCTTGTACCTGGTCCTTCTGTTTGGCCACACTACTCTTTCTCTTGCTGACCACGAAA
AATCCCAACATCTACAGGATGCCCCTCAGCAAAGTTACCTACTCTGAGGAGAACCGCATCTTCTACCTCC
AAAACAAGAAAAGGATGGTTGAAAGCCCCCTGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_028122
Insert Size 1155 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_028122.4, NP_082398.1
RefSeq Size 3675 bp
RefSeq ORF 1155 bp
Locus ID 108052
UniProt ID Q8VHL0
Cytogenetics 18 E3
Summary Urea channel that facilitates transmembrane urea transport down a concentration gradient. A constriction of the transmembrane channel functions as selectivity filter through which urea is expected to pass in dehydrated form. The rate of urea conduction is increased by hypotonic stress. Plays an important role in the kidney medulla collecting ducts, where it allows rapid equilibration between the lumen of the collecting ducts and the interstitium, and thereby prevents water loss driven by the high concentration of urea in the urine. Facilitates urea transport across erythrocyte membranes. May also play a role in transmembrane water transport, possibly by indirect means.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) is shorter than isoform 1. Variants 2 and 3 encode the same isoform (b).
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_028122" in other vectors (5)
SKU Description Size Price
MG205999 Slc14a1 (tGFP-tagged) - Mouse solute carrier family 14 (urea transporter), member 1 (Slc14a1) 10 ug
$657.00
MG216943 Slc14a1 (tGFP-tagged) - Mouse solute carrier family 14 (urea transporter) member 1 (Slc14a1) transcript variant 2, (10ug) 10 ug
$657.00
MR216943 Slc14a1 (Myc-DDK-tagged) - Mouse solute carrier family 14 (urea transporter), member 1 (Slc14a1), transcript variant 2 10 ug
$289.00 $457.00
MR216943L3 Lenti ORF clone of Slc14a1 (Myc-DDK-tagged) - Mouse solute carrier family 14 (urea transporter), member 1 (Slc14a1), transcript variant 2 10 ug
$757.00
MR216943L4 Lenti ORF clone of Slc14a1 (mGFP-tagged) - Mouse solute carrier family 14 (urea transporter), member 1 (Slc14a1), transcript variant 2 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products