OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Cd86 (NM_019388) Mouse Untagged Clone

Be the first to review this product
SKU
MC208265
Cd86 (untagged) - Mouse CD86 antigen (Cd86), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
  $450.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

TA386204 Recombinant Anti-CD86 (Clone PO.3)
200 ug
$770.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Cd86 or NM_019388"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Cd86
Synonyms B7; B7-2; B7.2; B70; Cd28l2; CLS1; ETC-1; Ly-58; Ly58; MB7; MB7-2; TS/A-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208265 representing NM_019388
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACCCCAGATGCACCATGGGCTTGGCAATCCTTATCTTTGTGACAGTCTTGCTGATCTCAGATGCTG
TTTCCGTGGAGACGCAAGCTTATTTCAATGGGACTGCATATCTGCCGTGCCCATTTACAAAGGCTCAAAA
CATAAGCCTGAGTGAGCTGGTAGTATTTTGGCAGGACCAGCAAAAGTTGGTTCTGTACGAGCACTATTTG
GGCACAGAGAAACTTGATAGTGTGAATGCCAAGTACCTGGGCCGCACGAGCTTTGACAGGAACAACTGGA
CTCTACGACTTCACAATGTTCAGATCAAGGACATGGGCTCGTATGATTGTTTTATACAAAAAAAGCCACC
CACAGGATCAATTATCCTCCAACAGACATTAACAGAACTGTCAGTGATCGCCAACTTCAGTGAACCTGAA
ATAAAACTGGCTCAGAATGTAACAGGAAATTCTGGCATAAATTTGACCTGCACGTCTAAGCAAGGTCACC
CGAAACCTAAGAAGATGTATTTTCTGATAACTAATTCAACTAATGAGTATGGTGATAACATGCAGATATC
ACAAGATAATGTCACAGAACTGTTCAGTATCTCCAACAGCCTCTCTCTTTCATTCCCGGATGGTGTGTGG
CATATGACCGTTGTGTGTGTTCTGGAAACGGAGTCAATGAAGATTTCCTCCAAACCTCTCAATTTCACTC
AAGAGTTTCCATCTCCTCAAACGTATTGGAAGGAGATTACAGCTTCAGTTACTGTGGCCCTCCTCCTTGT
GATGCTGCTCATCATTGTATGTCACAAGAAGCCGAATCAGCCTAGCAGGCCCAGCAACACAGCCTCTAAG
TTAGAGCGGGATAGTAACGCTGACAGAGAGACTATCAACCTGAAGGAACTTGAACCCCAAATTGCTTCAG
CAAAACCAAATGCAGAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_019388
Insert Size 930 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_019388.3, NP_062261.3
RefSeq Size 2539 bp
RefSeq ORF 930 bp
Locus ID 12524
UniProt ID P42082
Cytogenetics 16 25.72 cM
Summary Receptor involved in the costimulatory signal essential for T-lymphocyte proliferation and interleukin-2 production, by binding CD28 or CTLA-4. May play a critical role in the early events of T-cell activation and costimulation of naive T-cells, such as deciding between immunity and anergy that is made by T-cells within 24 hours after activation.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_019388" in other vectors (6)
SKU Description Size Price
MG227055 Cd86 (tGFP-tagged) - Mouse CD86 antigen (Cd86), (10ug) 10 ug
$650.00
MR227055 Cd86 (Myc-DDK-tagged) - Mouse CD86 antigen (Cd86) 10 ug
$450.00
MR227055L1 Lenti ORF clone of Cd86 (Myc-DDK-tagged) - Mouse CD86 antigen (Cd86) 10 ug
$750.00
MR227055L2 Lenti ORF clone of Cd86 (mGFP-tagged) - Mouse CD86 antigen (Cd86) 10 ug
$750.00
MR227055L3 Lenti ORF clone of Cd86 (Myc-DDK-tagged) - Mouse CD86 antigen (Cd86) 10 ug
$750.00
MR227055L4 Lenti ORF clone of Cd86 (mGFP-tagged) - Mouse CD86 antigen (Cd86) 10 ug
$750.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products