OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Ppp6c (NM_024209) Mouse Untagged Clone

Be the first to review this product
SKU
MC207641
Ppp6c (untagged) - Mouse protein phosphatase 6, catalytic subunit (Ppp6c), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Ppp6c or NM_024209"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ppp6c
Synonyms 2310003C10Rik; Pp6C
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207641 representing NM_024209
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGCCGCTGGATCTGGACAAGTATGTGGAGATAGCGCGGCAGTGCAAGTACCTTCCCGAGAACGACC
TGAAGAGGCTATGTGACTATGTTTGTGATCTGCTCTTGGAAGAGTCGAATGTTCAGCCAGTGTCAACGCC
AGTAACAGTGTGTGGTGACATACACGGACAGTTTTATGATCTTTGTGAACTGTTCAGAACTGGAGGTCAG
GTTCCTGACACAAACTACATATTTATGGGTGATTTTGTAGACAGAGGTTACTATAGTTTGGAGACCTTCA
CTTATCTTCTTGCACTAAAGGCTAAGTGGCCTGACCGTATTACACTTTTAAGAGGAAATCATGAGAGTAG
ACAGATAACACAGGTGTATGGATTTTATGATGAGTGCCAAACCAAATATGGAAATGCTAATGCCTGGAGA
TACTGTACCAAAGTTTTTGATATGCTCACAGTAGCAGCTTTAATAGATGAGCAGATTTTGTGTGTTCATG
GCGGTTTATCTCCTGATATCAAAACACTGGATCAAATTCGAACTATTGAACGAAATCAGGAAATTCCTCA
CAAAGGAGCATTTTGTGACTTGGTGTGGTCAGATCCTGAAGATGTGGACACTTGGGCAATCAGTCCCAGA
GGAGCAGGTTGGCTATTTGGAGCAAAAGTCACAAATGAGTTTGTTCATATCAACAACTTAAAACTCATCT
GCAGAGCACATCAGCTTGTGCACGAAGGCTATAAGTTTATGTTTGACGAGAAGCTGGTCACAGTGTGGTC
TGCTCCTAACTACTGCTATCGCTGTGGAAACATTGCTTCCATCATGGTCTTCAAAGATGTCAATACGAGA
GAACCAAAGTTATTCCGAGCAGTTCCAGATTCAGAACGTGTTATTCCTCCCAGAACCACGACGCCGTATT
TCCTTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_024209
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024209.2, NP_077171.1
RefSeq Size 1583 bp
RefSeq ORF 918 bp
Locus ID 67857
UniProt ID Q9CQR6
Cytogenetics 2 B
Summary Catalytic subunit of protein phosphatase 6 (PP6). PP6 is a component of a signaling pathway regulating cell cycle progression in response to IL2 receptor stimulation. N-terminal domain restricts G1 to S phase progression in cancer cells, in part through control of cyclin D1. During mitosis, regulates spindle positioning. Downregulates MAP3K7 kinase activation of the IL1 signaling pathway by dephosphorylation of MAP3K7. Participates also in the innate immune defense against viruses by desphosphorylating RIG-I/DDX58, an essential step that triggers RIG-I/DDX58-mediated signaling activation.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_024209" in other vectors (4)
SKU Description Size Price
MG204292 Ppp6c (tGFP-tagged) - Mouse protein phosphatase 6, catalytic subunit (Ppp6c) 10 ug
$500.00
MR204292 Ppp6c (Myc-DDK-tagged) - Mouse protein phosphatase 6, catalytic subunit (Ppp6c) 10 ug
$289.00 $300.00
MR204292L3 Lenti ORF clone of Ppp6c (Myc-DDK-tagged) - Mouse protein phosphatase 6, catalytic subunit (Ppp6c) 10 ug
$600.00
MR204292L4 Lenti ORF clone of Ppp6c (mGFP-tagged) - Mouse protein phosphatase 6, catalytic subunit (Ppp6c) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products