OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Scd2 (NM_009128) Mouse Untagged Clone

Be the first to review this product
SKU
MC207388
Scd2 (untagged) - Mouse stearoyl-Coenzyme A desaturase 2 (Scd2), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $503.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Scd2 or NM_009128"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Scd2
Synonyms mir-5114; Mir5114; Scd-2; swty
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207388 representing NM_009128
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGGCCCACATACTGCAAGAGATCTCTGGCGCTTACTCAGCCACCACCACAATCACAGCGCCACCTT
CTGGGGGACAGCAGAATGGAGGCGAGAAGTTTGAAAAGAGTTCTCACCACTGGGGAGCAGATGTTCGCCC
TGAACTAAAAGATGATCTATATGACCCCACCTATCAGGATGATGAGGGGCCCCCGCCCAAGCTGGAGTAC
GTCTGGAGGAACATCATTCTCATGGCCCTGCTGCATTTGGGAGCCTTGTACGGGATCACACTGGTTCCCT
CCTGCAAGCTCTACACCTGTCTCTTCGCGTATTTGTACTATGTAATCAGCGCCCTGGGCATCACAGCCGG
GGCTCATCGCCTGTGGAGCCACAGAACATACAAGGCACGGCTGCCCCTGAGGCTCTTCCTCATCATTGCC
AACACCATGGCGTTCCAGAATGACGTGTATGAATGGGCCCGAGATCACCGCGCCCACCACAAGTTCTCAG
AAACACACGCCGACCCTCACAATTCCCGCCGTGGCTTCTTTTTCTCTCACGTGGGTTGGCTGCTTGTGCG
CAAACACCCGGCTGTCAAAGAGAAGGGCGGAAAACTGGACATGTCTGACCTGAAAGCCGAGAAGCTGGTG
ATGTTCCAGAGGAGGTACTACAAGCCCGGCCTCCTGCTGATGTGCTTCGTCCTGCCCACGCTGGTGCCCT
GGTACTGCTGGGGCGAGACTTTTGTAAACAGCCTGTGCGTTAGCACCTTCTTGCGATACGCCGTGGTGCT
CAACGCCACCTGGCTGGTGAACAGTGCCGCCCACCTCTACGGATATCGCCCCTACGACAAGAACATTAGC
TCTCGGGAGAACATCTTGGTTTCCATGGGAGCTGTGGGCGAGGGCTTCCACAACTACCACCACGCCTTCC
CCTACGACTACTCTGCCAGTGAGTACCGCTGGCACATCAACTTCACCACGTTCTTCATCGATTGCATGGC
TCTCCTGGGCCTGGCTTACGACCGGAAGAGAGTGTCCAGGGCTGCTGTCTTGGCCAGGATTAAGAGAACT
GGAGACGGAAGCTGCAAGAGCGGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_009128
Insert Size 1077 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_009128.2, NP_033154.2
RefSeq Size 5453 bp
RefSeq ORF 1077 bp
Locus ID 20250
UniProt ID P13011
Cytogenetics 19 37.98 cM
Summary Stearyl-CoA desaturase that utilizes O(2) and electrons from reduced cytochrome b5 to introduce the first double bond into saturated fatty acyl-CoA substrates (PubMed:16443825). Catalyzes the insertion of a cis double bond at the delta-9 position into fatty acyl-CoA substrates including palmitoyl-CoA and stearoyl-CoA (PubMed:16443825). Gives rise to a mixture of 16:1 and 18:1 unsaturated fatty acids (PubMed:16443825). Contributes to the biosynthesis of membrane phospholipids, cholesterol esters and triglycerides, especially during embryonic development and in neonates (PubMed:16118274). Important for normal permeability barrier function of the skin in neonates (PubMed:16118274).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_009128" in other vectors (4)
SKU Description Size Price
MG205478 Scd2 (tGFP-tagged) - Mouse stearoyl-Coenzyme A desaturase 2 (Scd2) 10 ug
$489.00 $657.00
MR205478 Scd2 (Myc-DDK-tagged) - Mouse stearoyl-Coenzyme A desaturase 2 (Scd2) 10 ug
$289.00 $457.00
MR205478L3 Lenti ORF clone of Scd2 (Myc-DDK-tagged) - Mouse stearoyl-Coenzyme A desaturase 2 (Scd2) 10 ug
$757.00
MR205478L4 Lenti ORF clone of Scd2 (mGFP-tagged) - Mouse stearoyl-Coenzyme A desaturase 2 (Scd2) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products