OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Atg10 (BC023455) Mouse Untagged Clone

Be the first to review this product
SKU
MC206905
Atg10 (untagged) - Mouse autophagy-related 10 (yeast) (cDNA clone MGC:30984 IMAGE:5249268), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
2 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Atg10 or BC023455"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Atg10
Synonyms Agp10, APG10, Apg10p, Atg10l
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC206905 representing BC023455.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGATGAGTTCTTTGGAGAAAAAAGCTTCCAGCATTATTGTGCAGAATTCATCAGACATTCACAG
CAGATAGGCGATGGCTGGGAATGGAGAACAGCCAAGGAATGTTCTGATGGCTACATGTGCAAAACACAG
TTTCGAATAAAGAATGAGGCCTCGACACCACATGTGGGAACACCTGCCAGTGTGCTCACATGTCTCCCT
ACAGAGGAGAATTTAGAGCTACCAATGGATGATTCTGAAGTGACGAGACCTGCAGCGGTGGCAGAAGTG
ATTAAACATGAGTATCATGTCTTATACTCTTGTAGTTACCAAGTGCCGGTTCTTTACTTTAGGGCAAGC
TTTTTAGATGGGAGACCGTTAGCTCTGGAGGATATATGGGAAGGTGTTCATGAGTGCTATAAGCCGCGG
CTGCTCCAGGGACCGTGGGATACCATCACCCAGCAGGAACATCCAATACTTGGGCAACCATTTTTTGTT
CTACATCCCTGCAAGACAAATGAATTCATGACTGCTGTGCTAAAGAATTCACAGAAAATCAATAGAAAT
GTCAACTATATCACATCATGGCTGAGCCTCGTGGGGCCAGTGGTTGGTCTGAATTTACCTCTGAGCTAT
GCTAAAGCAACATCACAATCGGAGTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN BC023455
Insert Size 648 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC023455
RefSeq Size 1153 bp
RefSeq ORF 647 bp
Locus ID 66795
Cytogenetics 13 C3
MW 24.6 kDa
Summary E2-like enzyme involved in autophagy. Acts as an E2-like enzyme that catalyzes the conjugation of ATG12 to ATG5. ATG12 conjugation to ATG5 is required for autophagy. Likely serves as an ATG5-recognition molecule. Not involved in ATG12 conjugation to ATG3. Plays a role in adenovirus-mediated cell lysis.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"BC023455" in other vectors (4)
SKU Description Size Price
MG202364 Atg10 (tGFP-tagged) - Mouse autophagy-related 10 (yeast) (cDNA clone MGC:30984 IMAGE:5249268) 10 ug
$500.00
MR202364 Atg10 (Myc-DDK-tagged) - Mouse autophagy-related 10 (yeast) (cDNA clone MGC:30984 IMAGE:5249268) 10 ug
$289.00 $300.00
MR202364L3 Lenti ORF clone of Atg10 (Myc-DDK-tagged) - Mouse autophagy-related 10 (yeast) (cDNA clone MGC:30984 IMAGE:5249268) 10 ug
$600.00
MR202364L4 Lenti ORF clone of Atg10 (mGFP-tagged) - Mouse autophagy-related 10 (yeast) (cDNA clone MGC:30984 IMAGE:5249268) 10 ug
$600.00

file-alt Citations

Human adenovirus type 5 induces cell lysis through autophagy and autophagy-triggered caspase activity
Jiang, White, Ríos-Vicil et al
J. Virol. (2011) 85 (10), 4720-9 DOI: 10.1128/JVI.02032-10
Cited by 28
AI Summary: OriGene products contributed to this study by providing shRNA-expressing plasmids targeting ATG5 and ATG10, which were used to investigate the role of these autophagy genes in adenovirus-induced cell lysis.
Snippet: RNA interference.To knock down ATG5 and ATG10, we purchased small hairpin RNA (shRNA)-expressing plasmids from Origene (Rockville, MD). We transferred the plasmids into the cells with FuGENE 6. The cells were screened
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products