OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Pttg1 (BC023324) Mouse Untagged Clone

Be the first to review this product
SKU
MC206872
Pttg1 (untagged) - Mouse pituitary tumor-transforming 1 (cDNA clone MGC:35993 IMAGE:4946234), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
2 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Pttg1 or BC023324"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Pttg1
Synonyms PTTG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC206872 representing BC023324.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTACTCTTATCTTTGTTGATAAGGATAATGAAGAACCCGGCAGCCGTTTGGCTTCTAAGGATGGG
TTGAAGCTGGGCTCTGGTGTCAAGGCCTTAGATGGGAAATTGCAGGTTTCAACGCCTCGAGTCGGCAAA
GTGTTCAATGCTCCAGCCTTGCCTAAAGCCAGCAGAAAGGCTTTGGGGACAGTCAACAGAGTTGCCGAA
AAGCCTATGAAGACTGGTAAACCCCTCCAACCAAAACAGCCGACCTTGACTGGGAAAAAGATCACCGAG
AAGTCTACTAAGACACAAAGTTCTGTTCCTGCTCCTGATGATGCCTACCCAGAAATAGAAAAGTTCTTC
CCTTTCAATCCTCTAGATTTTGAGAGTTTTGACCTGCCTGAGGAGCACCAGATCTCACTTCTCCCCTTG
AATGGCGTGCCTCTCATGACCCTGAATGAAGAGAGAGGGCTGGAGAAGCTGCTGCATCTGGGCCCCCCT
AGCCCTCTGAAGACACCCTTTCTATCATGGGAATCTGATCCGCTGTACTCTCCTCCCAGTGCCCTCTCC
ACTCTGGATGTTGAATTGCCACCTGTTTGTTACGATGCAGATATTTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN BC023324
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC023324
RefSeq Size 746 bp
RefSeq ORF 599 bp
Locus ID 30939
Cytogenetics 11 B1.1
MW 21.7 kDa
Summary Regulatory protein, which plays a central role in chromosome stability, in the p53/TP53 pathway, and DNA repair. Probably acts by blocking the action of key proteins. During the mitosis, it blocks Separase/ESPL1 function, preventing the proteolysis of the cohesin complex and the subsequent segregation of the chromosomes. At the onset of anaphase, it is ubiquitinated, conducting to its destruction and to the liberation of ESPL1. Its function is however not limited to a blocking activity, since it is required to activate ESPL1. Negatively regulates the transcriptional activity and related apoptosis activity of p53/TP53. The negative regulation of p53/TP53 may explain the strong transforming capability of the protein when it is overexpressed. May also play a role in DNA repair via its interaction with Ku, possibly by connecting DNA damage-response pathways with sister chromatid separation (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"BC023324" in other vectors (4)
SKU Description Size Price
MG202008 Pttg1 (tGFP-tagged) - Mouse pituitary tumor-transforming 1 (cDNA clone MGC:35993 IMAGE:4946234) 10 ug
$500.00
MR202008 Pttg1 (Myc-DDK-tagged) - Mouse pituitary tumor-transforming 1 (cDNA clone MGC:35993 IMAGE:4946234) 10 ug
$289.00 $300.00
MR202008L3 Lenti ORF clone of Pttg1 (Myc-DDK-tagged) - Mouse pituitary tumor-transforming 1 (cDNA clone MGC:35993 IMAGE:4946234) 10 ug
$600.00
MR202008L4 Lenti ORF clone of Pttg1 (mGFP-tagged) - Mouse pituitary tumor-transforming 1 (cDNA clone MGC:35993 IMAGE:4946234) 10 ug
$600.00

file-alt Citations

PTTG1 Levels Are Predictive of Saracatinib Sensitivity in Ovarian Cancer Cell Lines
Nakachi, Helfrich, Spillman et al
Clin Transl Sci (2016)
AI Summary: OriGene products contributed to this study by providing the PTTG1 siRNA plasmids (GI340161 and GI340164), which were used to transiently silence PTTG1 in ovarian cancer cell lines to assess the impact on saracatinib sensitivity.
Snippet: above. RNA interference. PTTG1 was transiently silenced in the ES2 andMCAS (resistant) or SKOV3 (sensitive) cell lines using a combination of two siRNAsplasmids (GI340161 and GI340164, Origene, Rockville, MD). These ... Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products