OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Oaz1 (BC094287) Mouse Untagged Clone

Be the first to review this product
SKU
MC206846
Oaz1 (untagged) - Mouse ornithine decarboxylase antizyme (cDNA clone MGC:106390 IMAGE:5257966), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $165.00
2 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA360168 OAZ1 Antibody - middle region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Oaz1 or BC094287"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Oaz1
Synonyms ODC-Az, Oaz, AZ-1, Antizyme
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC206846 representing BC094287.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGAAATCCTCCCTGCAGCGGATCCTCAACAGCCACTGCTTCGCCAGAGAGAAGGAAGGGGACAAA
CGCAGCGCCACGCTTCACGCCAGCCGCACCATGCCGCTTCTTAGTCAGCACAGCCGCGGCGGCTGCAGC
AGCGAGAGGGTTGCCCTTAATTGCTGTAGTAACCTGGGTCCGGGGCCTCGGTGGTGCTCCTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN BC094287
Insert Size 201 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC094287
RefSeq Size 1022 bp
RefSeq ORF 200 bp
Locus ID 18245
Cytogenetics 10 39.72 cM
MW 7.2 kDa
Summary The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamine levels. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamines. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis; thus, completing the auto-regulatory circuit. This gene encodes antizyme 1, the first member of the antizyme family, that has broad tissue distribution, and negatively regulates intracellular polyamine levels by binding to and targeting ODC for degradation, as well as inhibiting polyamine uptake. Antizyme 1 mRNA contains two potential in-frame AUGs; and studies in rat suggest that alternative use of the two translation initiation sites results in N-terminally distinct protein isoforms with different subcellular localization. Alternatively spliced transcript variants have also been noted for this gene. provided by RefSeq, Dec 2014
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"BC094287" in other vectors (4)
SKU Description Size Price
MG200056 Oaz1 (tGFP-tagged) - Mouse ornithine decarboxylase antizyme (cDNA clone MGC:106390 IMAGE:5257966) 10 ug
$350.00
MR200056 Oaz1 (Myc-DDK-tagged) - Mouse ornithine decarboxylase antizyme (cDNA clone MGC:106390 IMAGE:5257966) 10 ug
$289.00
MR200056L3 Lenti ORF clone of Oaz1 (Myc-DDK-tagged) - Mouse ornithine decarboxylase antizyme (cDNA clone MGC:106390 IMAGE:5257966) 10 ug
$450.00
MR200056L4 Lenti ORF clone of Oaz1 (mGFP-tagged) - Mouse ornithine decarboxylase antizyme (cDNA clone MGC:106390 IMAGE:5257966) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products