OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Ang (NM_007447) Mouse Untagged Clone

Be the first to review this product
SKU
MC205895
Ang (untagged) - Mouse angiogenin, ribonuclease, RNase A family, 5 (Ang), transcript variant 1, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Ang or NM_007447"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ang
Synonyms AI385586; An; Ang1; Rn; Rnase5; Rnase5a
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC055355
CCTGTCTCCAGGAGCACGCAGCTAGACACATTCCCAGTCGGAGGAAAGCTGGCCAGCTTTGGAATCTCTG TTGGAAGAGATGGCGATAAGCCCAGGCCCGTTGTTCTTGATCTTCGTGCTGGGTCTGGTTGTGATCCCTC CCACTCTGGCTCAGGATGACTCCAGGTACACAAAATTCCTGACTCAGCACCATGACGCCAAGCCAAAGGG CCGGGACGACAGATACTGTGAACGTATGATGAAGAGAAGAAGCCTAACCTCACCCTGCAAAGATGTCAAC ACCTTTATCCATGGCAACAAGAGCAACATCAAGGCCATCTGTGGAGCGAATGGAAGCCCTTACAGAGAAA ACTTAAGAATGAGCAAGTCTCCCTTCCAGGTCACCACTTGCAAGCACACAGGAGGGTCTCCCCGGCCTCC ATGCCAGTACCGAGCCTCTGCAGGGTTCAGACATGTTGTTATTGCCTGTGAGAATGGCTTGCCGGTCCAC TTCGATGAGTCATTTTTCAGTCTATAGTCAGCAGGCCCCTGGCACAGACCTAGCTATGTTTTCTTTTTAT CTCCCCTCATAGCCCAGAACACTGGTTCCAGCGTTCATTGTCAGGGGCCAGAAAAACGAACTATCTAAAA CATATGTCTCCTGATTTGCAATGCACAGAAATAAAGATGTCTCAAAAGCCAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_007447
Insert Size 438 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC055355, AAH55355
RefSeq Size 695 bp
RefSeq ORF 438 bp
Locus ID 11727
UniProt ID P21570
Cytogenetics 14 26.37 cM
Summary This gene encodes a member of the pancreatic ribonuclease A superfamily and is a potent inducer of neovascularization. The encoded protein is a secreted multifunctional tRNA-specific ribonuclease that promotes angiogenesis in response to angiogenetic stimuli such as hypoxia, mediates stress-induced translational repression by cleaving cellular tRNAs, stimulates cell proliferation by mediating rRNA transcription in prostate cancer cells, and is involved in neurite pathfinding. This gene resides in a cluster of highly related genes. It shares dual promoters and 5' exons with the ribonuclease, RNase A family 4 gene. Two alternatively spliced variants, with different 5' exons but the same coding exon, have been identified. Multiple pseudogenes have been found for this gene. provided by RefSeq, Jun 2009
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_007447" in other vectors (4)
SKU Description Size Price
MG200967 Ang (tGFP-tagged) - Mouse angiogenin, ribonuclease A family, member 1 (Ang1) 10 ug
$489.00
MR200967 Ang (Myc-DDK-tagged) - Mouse angiogenin, ribonuclease, RNase A family, 5 (Ang), transcript variant 1 10 ug
$289.00
MR200967L3 Lenti ORF clone of Ang (Myc-DDK-tagged) - Mouse angiogenin, ribonuclease, RNase A family, 5 (Ang), transcript variant 1 10 ug
$450.00
MR200967L4 Lenti ORF clone of Ang (mGFP-tagged) - Mouse angiogenin, ribonuclease, RNase A family, 5 (Ang), transcript variant 1 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products