OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

2410015M20Rik (NM_153152) Mouse Untagged Clone

Be the first to review this product
SKU
MC205295
2410015M20Rik (untagged) - Mouse RIKEN cDNA 2410015M20 gene (2410015M20Rik), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA337628 Rabbit Polyclonal Anti-2410015M20Rik Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "2410015M20Rik or NM_153152"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol 2410015M20Rik
Synonyms Mic13; QIL1; sr104
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC056164
AGACTAACCATGGTGGCTCGAGTGTGGTCGCTAATGAGGTTCCTCATTAAGGGAAGTGTGGCTGGAGGAG CAGTCTACCTTGTTTATGACCAGGAGCTGCTGGGGCCTAGTGACAAGAGTGAGGCTGCCCTGCGGAAGGC CGAGGAGGTTGTGCCACCAGCAATGTACCAGTTCAGCCAATATGTGTGCCAGCAGACAGGTCTGGAGATG CCACAGCTCCCAACCCCTCCAAAGATTAAATTTCCAAACTTCCGTGATTCCTGGAACTCAGGCATCATCT CAGTCATGTCAGCCTTGTCGGTGGCCCCCTCCAAGGCCCGAGAATACTCCAAGGAGGGCTGGGAGTACCT CAAGGAACACAGCAAGTAATGGATGCCACCTGCCCCAGCATTATGGGGGTCAAGACCAGGATGGCAGAGA CATCCCAGTGGGGACCTCACTCTGAGGGCAGCTTCCAGCATTGCTGGCCCAATAAAGGACTTGGGAATGG TCAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI |
ACCN NM_153152
Insert Size 360 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC056164, AAH56164
RefSeq Size 517 bp
RefSeq ORF 360 bp
Locus ID 224904
UniProt ID Q8R404
Cytogenetics 17 D
Summary Component of the MICOS complex, a large protein complex of the mitochondrial inner membrane that plays crucial roles in the maintenance of crista junctions, inner membrane architecture, and formation of contact sites to the outer membrane. Constituent of mature MICOS complex, it is required for the formation of cristae junction (CJ) and maintenance of cristae morphology. Required for the incorporation of MICOS10/MIC10 into the MICOS complex.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_153152" in other vectors (4)
SKU Description Size Price
MG200557 2410015M20Rik (tGFP-tagged) - Mouse RIKEN cDNA 2410015M20 gene (2410015M20Rik) 10 ug
$350.00
MR200557 2410015M20Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 2410015M20 gene (2410015M20Rik) 10 ug
$289.00
MR200557L3 Lenti ORF clone of 2410015M20Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 2410015M20 gene (2410015M20Rik) 10 ug
$450.00
MR200557L4 Lenti ORF clone of 2410015M20Rik (mGFP-tagged) - Mouse RIKEN cDNA 2410015M20 gene (2410015M20Rik) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products