OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Il23a (NM_031252) Mouse Untagged Clone

Be the first to review this product
SKU
MC201218
Il23a (untagged) - Mouse interleukin 23, alpha subunit p19 (Il23a), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Il23a or NM_031252"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Il23a
Synonyms IL-23; p19
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC019953 sequence for NM_031252
TACAGAGTTAGACTCAGAACCAAAGGAGGTGGATAGGGGGTCCACAGGCCTGGTGCAGATCACAGAGCCA GCCAGATCTGAGAAGCAGGGAACAAGATGCTGGATTGCAGAGCAGTAATAATGCTATGGCTGTTGCCCTG GGTCACTCAGGGCCTGGCTGTGCCTAGGAGTAGCAGTCCTGACTGGGCTCAGTGCCAGCAGCTCTCTCGG AATCTCTGCATGCTAGCCTGGAACGCACATGCACCAGCGGGACATATGAATCTACTAAGAGAAGAAGAGG ATGAAGAGACTAAAAATAATGTGCCCCGTATCCAGTGTGAAGATGGTTGTGACCCACAAGGACTCAAGGA CAACAGCCAGTTCTGCTTGCAAAGGATCCGCCAAGGTCTGGCTTTTTATAAGCACCTGCTTGACTCTGAC ATCTTCAAAGGGGAGCCTGCTCTACTCCCTGATAGCCCCATGGAGCAACTTCACACCTCCCTACTAGGAC TCAGCCAACTCCTCCAGCCAGAGGATCACCCCCGGGAGACCCAACAGATGCCCAGCCTGAGTTCTAGTCA GCAGTGGCAGCGCCCCCTTCTCCGTTCCAAGATCCTTCGAAGCCTCCAGGCCTTTTTGGCCATAGCTGCC CGGGTCTTTGCCCACGGAGCAGCAACTCTGACTGAGCCCTTAGTGCCAACAGCTTAAGGATGCCCAGGTT CCCATGGCTACCATGATAAGACTAATCTATCAGCCCAGACATCTACCAGTTAATTAACCCATTAGGACTT GTGCTGTTCTTGTTTTGTTTGTTTTGCGTGAAGGGCAAGGACACCATTATTAAAGAGAAAAGAAACAAAC CCCAGAGCAGGCAGCTGGCTAGAGAAAGGAGCTGGAGAAGAAGAATAAAGTCTCGAGCCCTTGGCCTTGG AAGCGGGCAAGCAGCTGCGTGGCCTGAGGGGAAGGGGGCGGTGGCATCGAGAAACTGTGAGAAAACCCAG AGCATCAGAAAAAGTGAGCCCAGGCTTTGGCCATTATCTGTAAGAAAAACAAGAAAAGGGGAACATTATA CTTTCCTGGGTGGCTCAGGGAAATGTGCAGATGCACAGTACTCCAGACAGCAGCTCTGTACCTGCCTGCT CTGTCCCTCAGTTCTAACAGAATCTAGTCACTAAGAACTAACAGGACTACCAATACGAACTGACAAATAC TACCACTATGACCTGTGACAAAGCTGCATATTTATTAAGTGGGAAGGGAACTTTTGATATTATTTATCCT TGTAACAGTATAGATGATGGTTATTTATTCTATTTATAAGGAATTATGTATTTTTTTTTTCAATAAAGAT TTATTTATGTGGCTAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_031252
Insert Size 591 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC019953, AAH19953
RefSeq Size 1359 bp
RefSeq ORF 591 bp
Locus ID 83430
UniProt ID Q9EQ14
Cytogenetics 10 D3
Summary Associates with IL12B to form the IL-23 interleukin, a heterodimeric cytokine which functions in innate and adaptive immunity. IL-23 may constitute with IL-17 an acute response to infection in peripheral tissues. IL-23 binds to a heterodimeric receptor complex composed of IL12RB1 and IL23R, activates the Jak-Stat signaling cascade, stimulates memory rather than naive T-cells and promotes production of proinflammatory cytokines. IL-23 induces autoimmune inflammation and thus may be responsible for autoimmune inflammatory diseases and may be important for tumorigenesis.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_031252" in other vectors (4)
SKU Description Size Price
MG201920 Il23a (tGFP-tagged) - Mouse interleukin 23, alpha subunit p19 (Il23a) 10 ug
$500.00
MR201920 Il23a (Myc-DDK-tagged) - Mouse interleukin 23, alpha subunit p19 (Il23a) 10 ug
$289.00 $300.00
MR201920L3 Lenti ORF clone of Il23a (Myc-DDK-tagged) - Mouse interleukin 23, alpha subunit p19 (Il23a) 10 ug
$600.00
MR201920L4 Lenti ORF clone of Il23a (mGFP-tagged) - Mouse interleukin 23, alpha subunit p19 (Il23a) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products