OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Vps72 (NM_009336) Mouse Untagged Clone

Be the first to review this product
SKU
MC200434
Vps72 (untagged) - Mouse vacuolar protein sorting 72 (yeast) (Vps72), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA355603 Vps72 Antibody - N-terminal region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Vps72 or NM_009336"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Vps72
Synonyms Tcfl1; YL-1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC004834 sequence for NM_009336
GGCTGAAGGCGGCAGCGCAGTCGCTGTAGGCGGTATGAGTTTGGCTGGGGGCCGGGCCCCACGGAAAACC GCTGGGAACCGGCTTTCTGGGCTCCTGGAAGCAGAGGAGGAAGATGAGTTCTACCAGACAACTTACGGGG GTTTCACCGAGGAATCTGGAGATGATGAGTATCAAGGAGACCAGTCTGATACGGAGGATGAGGTAGACTC TGACTTTGACATTGATGAAGGGGATGAACCATCCAGTGATGGAGAATCGGAAGAGCCAAGAAGGAAGCGC AGAGTCGTCACCAAAGCCTATAAGGAGCCTCTAAAGAGCTTGAGGCCTCGCAAGGTCAGCACCCCAGCAA GCAGCTCCCAGAAGGCCAGAGAGGAGAAGACGCTGCTGCCACTGGAGCTCCAGGACGATGGCTCTGACAG CCGCAAGTCTATGCGTCAGTCTACAGCTGAGCACACACGACAAACGTTCCTTCGGGTTCAAGAGAGGCAA GGACAGTCCCGGAGGCGGAAGGGTCCCCACTGTGAGCGACCACTAACCCAGGAAGAGCTGCTCAGGGAGG CCAAGATCACTGAAGAGCTCAACTTACGTTCACTCGAGACCTATGAAAGGCTGGAGGCTGACAAAAAGAA GCAGGTTCACAAGAAGCGGAAGTGCCCTGGGCCAATAATCACCTACCACTCAGTGACGGTGCCGCTTGTT GGGGAGCCCGGCCCCAAGGAGGAAAATGTGGACGTGGAAGGCCTTGATCCTGCTCCTACAGCCTCTGCAC TGGCTCCACATGCTGGGACCGGGACTGGAGCTGCCGCTGCCGCCCCTCCTGCTCACTGCTCTCGCACCTT CATCACGTTCAGTGATGATGCAACGTTTGAAGAGTGGTTCCCCCAGGGGCGACCCCCGAAGGTCCCGGTG CGGGAGGTCTGCCCAGTGACCCACCGTCCAGCTTTGTACCGGGACCCTGTTACAGACATACCCTATGCCA CTGCTAGAGCCTTCAAGATCATCCGTGAGGCGTACAAGAAGTACATCACTGCCCACGGACTTCCACCCAC CGCCTCGGCGCTGGGCCCCGGACCCCCACCCCCCGAGCCACTACCTGGCTCTGGGCCTCGAGCCTTGCGT CAGAAGATTGTCATCAAATAGAGACACCTGACCCCTAGACAGTCCCTCTCCTCTCCTAACCTGGCTCTCC ACTCCGCCCTCCCTTCTGCCGACCTTCGCCCTTGTTTCCCTCAGTTCCTCCCTAGTTCATTTCATTTACT TGTGCTCTTCATTTTTTTAATCTAATAAAATGGTAAAATCCTAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_009336
Insert Size 1107 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC004834, AAH04834
RefSeq Size 1318 bp
RefSeq ORF 1107 bp
Locus ID 21427
UniProt ID Q62481
Cytogenetics 3 F2.1
Summary Deposition-and-exchange histone chaperone specific for H2AFZ, specifically chaperones H2AFZ and deposits it into nucleosomes. As component of the SRCAP complex, mediates the ATP-dependent exchange of histone H2AFZ/H2B dimers for nucleosomal H2A/H2B, leading to transcriptional regulation of selected genes by chromatin remodeling.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_009336" in other vectors (4)
SKU Description Size Price
MG205675 Vps72 (tGFP-tagged) - Mouse vacuolar protein sorting 72 (yeast) (Vps72) 10 ug
$657.00
MR205675 Vps72 (Myc-DDK-tagged) - Mouse vacuolar protein sorting 72 (yeast) (Vps72) 10 ug
$289.00 $457.00
MR205675L3 Lenti ORF clone of Vps72 (Myc-DDK-tagged) - Mouse vacuolar protein sorting 72 (yeast) (Vps72) 10 ug
$757.00
MR205675L4 Lenti ORF clone of Vps72 (mGFP-tagged) - Mouse vacuolar protein sorting 72 (yeast) (Vps72) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products