OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TissueScan, Gastroesophageal Cancer cDNA Array

Be the first to review this product
SKU
HGRT101
48 samples covering 6-normal, 1-Stage IA, 2-IB, 7-I, 2-IIA, 4-IIB, 3-II, 2-IIIA, 10-III, 5-IV, 6-GIST. Available in 2, 5, 10 identical plates.
  $1,060.00
In Stock*

Frequently Bought Together (4)

D11-18 Polink-1 HRP Polymer Detection for MOUSE and RABBIT antibodies on human tissue
18 ml
$420.00
D12-6 Polink-1 HRP Polymer Detection for MOUSE antibody on human or animal tissue (non-rodent)
6 ml
$250.00
HP205798 qSTAR qPCR primer pairs against Homo sapiens gene GAPDH 200 reactions
$150.00
MP205604 qSTAR qPCR primer pairs against Mus musculus gene Gapdh 200 reactions
$150.00
Specifications
Specifications
Product Data
TissueScan Type Cancer Specific
Array Name Gastroesophageal Cancer cDNA Array
Clinical Info
Diagnosis Category Gastroesophageal Cancer
Tissue Stomach, Esophagus
Shipping Ambient
Description 48 samples covering 6-normal, 1-Stage IA, 2-IB, 7-I, 2-IIA, 4-IIB, 3-II, 2-IIIA, 10-III, 5-IV, 6-GIST. Available in 2, 5, 10 identical plates.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Expression of the Niemann-Pick C1-like 1 Protein in Gastric Cancer
Imai, Futamura, Mori et al
Anticancer Res (2025) 45 (3), 965-975 DOI: 10.21873/anticanres.17484
AI Summary: OriGene’s TissueScan Gastroesophageal Cancer Tissue qPCR Panel I (cat. no.: HGRT101) was used in this study to analyze NPC1L1 gene expression patterns in human gastric cancer tissues.
Snippet: Multiple Tissue cDNA Panel (cat. no.: 636746;Takara‑bio Co.) was used to represent normal human digestive organ tissues;and TissueScan Gastroesophageal Cancer Tissue qPCR Panel I (cat. no.: HGRT101;OriGene Technologies, Rockville, MD, USA) was used to represent human GC tissue
Heterogeneous Cadherin Expression and Multicellular Aggregate Dynamics in Ovarian Cancer Dissemination
Klymenko, Johnson, Bos et al
Neoplasia (2017) 19 (7), 549-563 DOI: 10.1016/j.neo.2017.04.002
AI Summary: OriGene’s TissueScan cDNA arrays (HORT-01) were used in this study to quantitatively analyze cadherin gene expression patterns in ovarian cancer tissues, enabling the researchers to correlate cadherin profiles with tumor differentiation and metastatic behavior.
Snippet: Cells were incubated at 37°C for 48 hours, and MCA formation was confirmed under the light microscope. Quantitative Polymerase Chain Reaction of cDNA Arrays. Ovarian cancer TissueScan cDNA arrays (HORT-01) were obtained from OriGene.
Transcriptome-wide analysis of alternative RNA splicing events in Epstein-Barr virus-associated gastric carcinomas
Armero, Tremblay, Allaire et al
PLoS ONE (2017) 12 (5), e0176880 DOI: 10.1371/journal.pone.0176880
AI Summary: OriGene’s TissueScan Gastroesophageal Cancer cDNA Array plates were used in this study to assess the expression of alternatively spliced transcripts in gastric cancer samples, enabling experimental validation of RNA sequencing findings.
Snippet: localization signal) [27]. PCR validation. Gastroesophageal cancer cDNA Arrays form Origene TissueScan plates (Rockville, MD) were assessed for the expression of the various transcripts using the manufacturer's protocol. The plates ... All 6 versions Cite SaveSaving
FigureFigureFigure
SETD6 regulates NF-κB signaling in urothelial cell survival: Implications for bladder cancer
Mukherjee, Cardenas, Bedolla et al
Oncotarget (2017) 8 (9), 15114-15125 DOI: 10.18632/oncotarget.14750
Snippet: cDNA array (Origene, TissueScan Cancer and Normal Tissue cDNA Arrays) was used to determine the level of SETD6 expression in different bladder tissue samples (n = 24). SETD6 primer (Integrated DNA Technologies, SETD6: forward- AGCTTTCAGGAACCACTGGAGGAA, reverse- ATGGCCTTTAGGAATGGGCTGAGT) was mixed with PCR master mix, equal volumes were added to each well of the same plate and subjected to real-ti...
FigureFigureFigure
Human helicase RECQL4 drives cisplatin resistance in gastric cancer by activating an AKT-YB1-MDR1 signaling pathway
Mo, Fang, Niu et al
Cancer Res. (2016)
AI Summary: OriGene’s TissueScan Human gastroesophageal cancer tissue qPCR array (HGRT101) was used in this study to analyze RECQL4 mRNA expression levels in human gastric cancer and normal tissues, aiding in the identification of RECQL4 upregulation in cancer samples.
Snippet: TissueScan Human gastroesophogeal cancer tissue qPCR array was ordered from Origene (#HGRT101, Rockville, MD 20850). Eleven pairs of human gastric ... using TissueScan Human gastroesophageal cancer tissue qPCR array (Origene). This ... Cite SaveSaving
Overexpression of peptide deformylase in breast, colon, and lung cancers
Randhawa, Chikara, Gehring et al
BMC Cancer (2013) 13, 321 DOI: 10.1186/1471-2407-13-321
Cited by 31
AI Summary: OriGene’s TissueScan Cancer qPCR Arrays were used in this study to measure mRNA expression levels of PDF and MAP1D across various normal and cancer tissue samples, enabling the identification of their overexpression in breast, colon, and lung cancers.
Snippet: TissueScan Cancer qPCR Arrays containing cDNA from normal and cancer tissue samples were purchased from Origene (Rockville, MA). ... The CyQUANT (Life Technologies;Grand Island, NY) cell proliferation assay was performed according to the manufacturer's instructions.
FigureFigureFigure
Showing 1-6 of 9 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products