OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Gabrg2 Mouse shRNA Plasmid (Locus ID 14406)

Be the first to review this product
SKU
TL515175
Gabrg2 - Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
2 Weeks*

Frequently Bought Together (3)

EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Gabrg2 or NM_008073"

Specifications
Specifications
Product Data
Locus ID 14406
Synonyms GABAA-R; Gabrg-2; gamma2
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components Gabrg2 - Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 14406). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq BC031762, NM_008073, NM_177408, NM_008073.1, NM_008073.2, NM_008073.3, NM_177408.1, NM_177408.2, NM_177408.3, NM_177408.4, NM_177408.5, NM_177408.6, NM_001362655, NM_001362656, NM_177408.7, NM_008073.4
UniProt ID P22723
Summary This gene encodes a gamma-aminobutyric acid (GABA)-A receptor subunit, which is a member of the ligand-gated ion channel family. GABA is the major inhibitory neurotransmitter in the adult central nervous system, and conversely exhibits an excitatory function during development. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. This gene encodes one of three gamma subunits in mammals, which contain the binding site for benzodiazepine drugs. Several mutations in this gene are associated with epileptic seizures, and genetic knockdown is associated with anxiety behavior. Alternative splicing results in multiple transcript variants. provided by RefSeq, Jan 2013
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Activity in the dorsal hippocampus-mPFC circuit modulates stress-coping strategies during inescapable stress
Yoon, Song, Chung et al
Exp Mol Med (2024)
Cited by 17
AI Summary: OriGene’s pGFP-V-RS vector containing shRNA constructs (Cat. #TL515175) and a nontargeting pGFP-V-RS plasmid were used in this study to manipulate gene expression in neurons, enabling investigation of the dorsal hippocampus's role in stress-coping behaviors.
Snippet: caatggat;#4: tggattgaggaatacaactgaagtagtga) constructs in the pGFP-V-RS vector and a nontargeting (NT: gcactaccagagctaactcagatagtact) pGFP-V-RS plasmid were purchased from OriGene (Cat. #TL515175). For lentivirus-mediated expression, cassettes containing the human U6 (hU6) promoter-shRNA#3 and hU6-NT were amplified by PCR and then subcloned and inserted into the pLVX-DsRed-Monomer-C1 (Clontech) vector, displacing the CMV promoter-DsRed-Monomer cassette. …
Shifting hippocampal excitation/inhibition balance modifies despair-like behavior in mice
Yoon, Chung, Song et al
bioRxiv (2020)
Cited by 6
Snippet: …Cached;For Gabrg2 knockdown assay, Gabrg2 cDNA was amplified from mouse hippocampal cDNA and was cloned into pGW1 vector. Four independent shRNA (#1: gcattggaagctcagtctactctcctgta;#2: tggaatgatggtcgagttctctacacctt;#3: ccaaggtctcctatgtcacagcaatggat;#4: tggattgaggaatacaactgaagtagtga) constructs in the pGFP-VRS vector and a non-targeting (NT: gcactaccagagctaactcagatagtact) pGFP-V-RS plasmid were purchased from OriGene (Cat. # TL515175
Hippocampal GABA-inhibitory circuitry regulates despair-like behavior in mice
Yoon, Chung, Song et al
bioRxiv (2020)
Cited by 6
Snippet: … Hippocampal GABA-inhibitory circuitry regulates despair-like behavior in mice Sang Ho Yoon1,2, Geehoon Chung1,4, Woo Seok Song1,2, Sung Pyo Oh1, Sang Jeong Kim1,2, and Myoung-Hwan Kim1,2,3* 1Department;2: tggaatgatggtcgagttctctacacctt;#3: ccaaggtctcctatgtcacagcaatggat;#4: tggattgaggaatacaactgaagtagtga) constructs in the pGFP-V-RS vector and a non-targeting (NT: gcactaccagagctaactcagatagtact) pGFP-V-RS plasmid were purchased from OriGene (Cat. # TL515175). …
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products