OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Depdc5 Mouse shRNA Plasmid (Locus ID 277854)

Be the first to review this product
SKU
TL508165
Depdc5 - Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
In Stock*

Frequently Bought Together (3)

EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Depdc5 or NM_001025426"

Specifications
Specifications
Product Data
Locus ID 277854
Synonyms AV016528
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components Depdc5 - Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 277854). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq BC072604, NM_001025426, NM_001170567, NM_177786, NM_001360014, NM_001025426.1, NM_001025426.2, NM_177786.1, NM_177786.2, NM_177786.3, NM_177786.4, NM_001170567.1
UniProt ID P61460
Summary As a component of the GATOR1 complex functions as an inhibitor of the amino acid-sensing branch of the TORC1 pathway. The GATOR1 complex strongly increases GTP hydrolysis by RRAGA and RRAGB within RRAGC-containing heterodimers, thereby deactivating RRAGs, releasing mTORC1 from lysosomal surface and inhibiting mTORC1 signaling. The GATOR1 complex is negatively regulated by GATOR2 the other GATOR subcomplex in this amino acid-sensing branch of the TORC1 pathway.UniProtKB/Swiss-Prot Function
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

DEPDC5-dependent mTORC1 signaling mechanisms are critical for the anti-seizure effects of acute fasting
Yuskaitis, Modasia, Schrötter et al
Cell Rep (2022) 40 (9), 111278 DOI: 10.1016/j.celrep.2022.111278
Cited by 25
AI Summary: In this study, OriGene’s shDepdc5 (TL705799) and scrambled shRNA control (TR30021) were used to achieve neuronal Depdc5 knockdown, enabling the investigation of DEPDC5's role in mTORC1 signaling and the anti-seizure effects of fasting.
Snippet: fter transfection and filtered through a 0.45 mm membrane. Rat neurons were infected at 1 day in vitro (DIV1) for 6 h then replaced by fresh NB/B27 medium. Depdc5 knockdown was achieved by (sh) RNAs (Origene, TL705799) and a non-effective 29-mer scrambled shRNA (Scr) construct (Origene, TR30021) in a pGFP-C-Lenti vector. Sequences used were shDepdc5: TGTCCGA CCTGGAGGATACACGCCTCAGA and shScramble:
Acute knockdown of Depdc5 leads to synaptic defects in mTOR-related epileptogenesis
De Fusco, Cerullo, Marte et al
Neurobiol. Dis. (2020) 139, 104822 DOI: 10.1016/j.nbd.2020.104822
Cited by 38
AI Summary: OriGene’s Depdc5 shRNA constructs (TL508165) and scrambled shRNA control (TR30021) were used to acutely silence Depdc5 expression in neurons, enabling the study to reveal dose-dependent synaptic defects linked to epileptogenesis.
Snippet: Four distinct short hairpin (sh) RNAs (Origene, TL508165) and a non-effective 29-mer scrambled shRNA (Scr) construct (Origene, TR30021) in a pGFP-C-Lenti vector were used to acutely silence Depdc5 expression. …
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products