OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Cav1 Mouse shRNA Plasmid (Locus ID 12389)

Be the first to review this product
SKU
TL500281
Cav1 - Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
In Stock*

Frequently Bought Together (3)

EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Cav1 or NM_001243064"

Specifications
Specifications
Product Data
Locus ID 12389
Synonyms Cav; Cav-1
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components Cav1 - Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 12389). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq BC038280, BC052859, NM_001243064, NM_007616, NM_007616.1, NM_007616.2, NM_007616.3, NM_007616.4, NM_001243064.1
UniProt ID P49817
Summary May act as a scaffolding protein within caveolar membranes (By similarity). Forms a stable heterooligomeric complex with CAV2 that targets to lipid rafts and drives caveolae formation. Mediates the recruitment of CAVIN proteins (CAVIN1/2/3/4) to the caveolae (PubMed:19546242). Interacts directly with G-protein alpha subunits and can functionally regulate their activity (By similarity). Involved in the costimulatory signal essential for T-cell receptor (TCR)-mediated T-cell activation. Its binding to DPP4 induces T-cell proliferation and NF-kappa-B activation in a T-cell receptor/CD3-dependent manner (By similarity). Recruits CTNNB1 to caveolar membranes and may regulate CTNNB1-mediated signaling through the Wnt pathway (PubMed:10816572). Negatively regulates TGFB1-mediated activation of SMAD2/3 by mediating the internalization of TGFBR1 from membrane rafts leading to its subsequent degradation (By similarity).UniProtKB/Swiss-Prot Function
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Cell entry of avian reovirus follows a caveolin-1-mediated and dynamin-2-dependent endocytic pathway that requires activation of p38 mitogen-activated protein kinase (MAPK) and Src signaling pathways as well as microtubules and small GTPase Rab5 protein
Huang, Wang, Chi et al
J. Biol. Chem. (2011) 286 (35), 30780-94 DOI: 10.1074/jbc.M111.257154
Cited by 15
AI Summary: OriGene’s dynamin-2 human shRNA (TG313406) and dynamin-2 siRNA construct (GI353617) were used in this study to effectively knock down dynamin-2 expression, helping to demonstrate its essential role in avian reovirus entry via a caveolin-1-mediated, dynamin-2-dependent endocytic pathway.
Snippet: V-RS vector and pGFP-V-RS vector) according to the manufacturer's instructions (dynamin-2 human shRNA, TG313406, OriGene Co.). ... and dynamin-2 siRNA construct GI353617 (CTACGGACCATCGGTGTCATCACCAAGCT) resulted in the most significant down-regulation
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products