OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MET Human shRNA Plasmid Kit (Locus ID 4233)

Be the first to review this product
SKU
TL320418
MET - Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
In Stock*

Frequently Bought Together (4)

TA805795 MET mouse monoclonal antibody, clone OTI1E6 (formerly 1E6) 100 ul
$447.00
EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MET or NM_000245"

Specifications
Specifications
Product Data
Locus ID 4233
Synonyms AUTS9; c-Met; DFNB97; HGFR; RCCP2
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components MET - Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 4233). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq NM_000245, NM_001127500, NM_001324401, NM_001324402, NM_000245.1, NM_000245.2, NM_000245.3, NM_001127500.1, NM_001127500.2, BC016592, BC027979, BC127890, BC130420, NM_001127500.3, NM_000245.4
UniProt ID P08581
Summary This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. provided by RefSeq, May 2016
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Crizotinib Has Preclinical Efficacy in Philadelphia-Negative Myeloproliferative Neoplasms
Gurska, Okabe, Schurer et al
Clinical Cancer Research (2023)
AI Summary: OriGene contributed to this study by providing shRNA lentiviral constructs (catalog number TL320418) used to knock down RON expression, enabling the researchers to investigate the role of RON in JAK/STAT signaling and MPN cell proliferation.
Snippet: TL320418) were purchased from Origene. Each kit contained 4 unique 29mer shRNA constructs in a lentiviral GFP vector. As a control, a noneffective 29-mer scrambled
Role of HGF/c-Met in the treatment of colorectal cancer with liver metastasis
Yao, Li, Yan et al
J. Biochem. Mol. Toxicol. (2019)
AI Summary: OriGene’s shRNA design software was used in this study to design the short-hairpin RNA sequences targeting c-Met, enabling the researchers to investigate the effects of c-Met downregulation on colorectal cancer liver metastasis.
Snippet: The short‐hairpin RNA (shRNA) design software (OriGene;OriGene Technologies Inc., MD) was used to determine the target gene sequence 5′‐TCAACTTCTTTGTAGGCAATA‐ 3′, as the candidate;and the synthetic sequence 5′‐TTCTCCGAACGTGTC ACGT
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products