OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SOX9 Human shRNA Plasmid Kit (Locus ID 6662)

Be the first to review this product
SKU
TL309170
SOX9 - Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
In Stock*

Frequently Bought Together (4)

TA802387 SOX9 mouse monoclonal antibody, clone OTI2H10 (formerly 2H10) 100 ul
$447.00
EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SOX9 or NM_000346"

Specifications
Specifications
Product Data
Locus ID 6662
Synonyms CMD1; CMPD1; SRA1; SRXX2; SRXY10
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components SOX9 - Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 6662). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq NM_000346, NM_000346.1, NM_000346.2, NM_000346.3, BC056420, BC056420.1, BC007951, BC018276, NM_000346.4
UniProt ID P48436
Summary The protein encoded by this gene recognizes the sequence CCTTGAG along with other members of the HMG-box class DNA-binding proteins. It acts during chondrocyte differentiation and, with steroidogenic factor 1, regulates transcription of the anti-Muellerian hormone (AMH) gene. Deficiencies lead to the skeletal malformation syndrome campomelic dysplasia, frequently with sex reversal. provided by RefSeq, Jul 2008
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Incomplete radiofrequency ablation promotes the development of CD133+ cancer stem cells in hepatocellular carcinoma cell line HepG2 via inducing SOX9 expression
Yuan, Wang, Liu et al
HBPD INT (2018)
AI Summary: OriGene’s lentiviral shRNA constructs targeting SOX9 were used to generate SOX9 knockdown HepG2 cells, enabling the study to demonstrate SOX9’s key role in promoting cancer stemness and tumorigenicity after incomplete radiofrequency ablation.
Snippet: shRNA-mediated interference was used to create SOX9 knockdown cells in HepG2 cells, as described previously [19]. Cells were transfected with lentiviral constructs expressing shRNAs of SOX9 (OriGene, MD, USA) or control shRNA (shCtrl) for 24 hours
SOX9 Transcriptionally Regulates mTOR-Induced Proliferation of Basal Cell Carcinomas
Kim, Back, Chaudhary et al
J. Invest. Dermatol. (2018) 138 (8), 1716-1725 DOI: 10.1016/j.jid.2018.01.040
AI Summary: OriGene’s 29mer shRNA constructs targeting SOX9 (shSOX9-1, shSOX9-2, shSOX9-3) and scrambled control shRNA were used to generate stable SOX9 knockdown cell lines, enabling the authors to investigate SOX9’s role in mTOR-mediated proliferation of basal cell carcinomas.
Snippet: shRNA constructs that target both mouse and human SOX9 (29mer shRNA constructs in lentiviral GFP vector [Locus ID 6662]), and scrambled control shRNA were purchased from OriGene (Rockville, MD). Transduction and generation of stable SOX9 knockdown ASZ001 and HEK293T cell lines were performed using shSOX9-1 (TGCATCCGCGAGGCGGTCAGCCAGGTGCT), shSOX9-2 (GTGCGCGTCAACGGCTCCAGCAAGAACAA), and shSOX9-3 (CAGCGAACGCACATCAAGACGGAGCAGCT),
FigureFigure
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products