OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

NIR1 (PITPNM3) Human shRNA Plasmid Kit (Locus ID 83394)

Be the first to review this product
SKU
TL302471
PITPNM3 - Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
In Stock*

Frequently Bought Together (4)

TA308307 Rabbit polyclonal antibody to NIR1 (PITPNM family member 3)
100 ul
$665.00
EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "NIR1 or NM_001165966"

Specifications
Specifications
Product Data
Locus ID 83394
Synonyms ACKR6; CORD5; NIR1; RDGBA3
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components PITPNM3 - Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 83394). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq NM_001165966, NM_031220, NM_031220.1, NM_031220.2, NM_031220.3, NM_001165966.1, BC020484, BC035799, BC128583, BC128584, NM_031220.4, NM_001165966.2
UniProt ID Q9BZ71
Summary This gene encodes a member of a family of membrane-associated phosphatidylinositol transfer domain-containing proteins. The calcium-binding protein has phosphatidylinositol (PI) transfer activity and interacts with the protein tyrosine kinase PTK2B (also known as PYK2). The protein is homologous to a Drosophila protein that is implicated in the visual transduction pathway in flies. Mutations in this gene result in autosomal dominant cone dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene.provided by RefSeq, Sep 2009
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Chemokine CCL18 Promotes Phagocytosis Through Its Receptor CCR8 Rather than PITPNM3 in Human Microglial Cells
Ding, Zhang, Liu et al
J Interferon Cytokine Res (2022) 42 (1), 19-28 DOI: 10.1089/jir.2021.0123
Cited by 4
AI Summary: OriGene products—specifically, the negative control shRNA (TR30021), CCR8 shRNA (TL314123), and PITPNM3 shRNA (TL302471)—were used to selectively knock down CCR8 and PITPNM3 in human microglial cells, enabling the authors to determine that CCR8, but not PITPNM3, mediates CCL18-induced phagocytosis.
Snippet: A non-effective negative control shRNA (TR30021), a shRNA against CCR8 (TL314123), and a shRNA against PITPNM3 (TL302471) were obtained from Origene, USA. The sequences of the shRNAs were as follows: CCR8-shRNA: TTCAGACCTACTATCTGCTGGACCAGTGG PITPNM3-shRNA: GAAGAACAACTCGCGCATGATCCTGCGCA
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products