NQO2 (NM_000904) Human Recombinant Protein
$737.00
In Stock*
Specifications
| Product Data | |
| Species | Human |
|---|---|
| Expression Host | HEK293 |
| Expression cDNA Clone or AA Sequence | |
| Tag | C-Myc/DDK |
| Predicted MW | 25.7 kDa |
| Concentration | >0.05 µg/µL as determined by microplate BCA method |
| Purity | > 80% as determined by SDS-PAGE and Coomassie blue staining |
| Buffer | 25 mM Tris-HCl, 100 mM glycine, pH 7.3, 10% glycerol |
| Preparation | Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. |
| Note | For testing in cell culture applications, please filter before use. Note that you may experience some loss of protein during the filtration process. |
| Storage | Store at -80°C. |
| Stability | Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. |
| Shipping | Dry Ice |
| Reference Data | |
| RefSeq | NP_000895 |
| Locus ID | 4835 |
| UniProt ID | P16083 |
| Cytogenetics | 6p25.2 |
| RefSeq Size | 1272 |
| RefSeq ORF | 693 |
| Synonyms | DHQV; DIA6; NMOR2; QR2 |
| Summary | This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants. provided by RefSeq, Mar 2014 |
| Protein Categories | Cancer: Gynecologic, Intracellular Proteins |
Reviews
Documents
| FAQs |
| SDS |
Resources
| Recombinant Protein Resources |
Other "NQO2" proteins (3)
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| PH302889 | NQO2 MS Standard C13 and N15-labeled recombinant protein (NP_000895) | 10 ug |
$3,360.00
|
|
| LC424463 | Lyophilized NQO2 HEK293T cell transient overexpression lysate (as WB positive control) | 20 ug |
$206.00
|
|
| LY424463 | Transient overexpression lysate of NAD(P)H dehydrogenase, quinone 2 (NQO2) (as WB positive control) | 100 ug |
$436.00
|
|
Citations
Reduction and scavenging of chemically reactive drug metabolites by NAD(P)H:quinone oxidoreductase 1 and NRH:quinone oxidoreductase 2 and variability in hepatic concentrations
den Braver-Sewradj, den Braver, Toorneman et al
Chem. Res. Toxicol. (2017)
den Braver-Sewradj, den Braver, Toorneman et al
Chem. Res. Toxicol. (2017)
AI Summary: OriGene’s human NQO2 cDNA ORF clone (catalog number SC319150) was used to generate recombinant NQO2 for expression and purification, enabling the study of its enzymatic activity in reducing and scavenging reactive drug metabolites in human liver.
Snippet: Expression and purification of recombinant human NQO2 NQO2 DNA was obtained by PCR amplification from the human cDNA ORF clone (SC319150, obtained from OriGene Technologies, Rockville, MD) using the forward primer 5'- GCAACATATGGCAGGTAAGAAAGTAC View as HTML;ADVERTISEMENT;Expression and purification of recombinant human NQO2 NQO2 DNA was obtained by PCR amplification from the human cDNA ORF clone (SC319150, obtained from OriGene Technologies, Rockville, MD) using the forward primer 5'- GCAACATATGGCAGGTAAGAAAGTAC
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
