Neurogranin (NRGN) (NM_006176) Human Recombinant Protein
SKU
TP301209
Recombinant protein of human neurogranin (protein kinase C substrate, RC3) (NRGN), transcript variant 1, 20 µg
$867.00
5 Days*
Specifications
| Product Data | |
| Species | Human |
|---|---|
| Expression Host | HEK293 |
| Expression cDNA Clone or AA Sequence | |
| Tag | C-Myc/DDK |
| Predicted MW | 7.4 kDa |
| Concentration | >0.05 µg/µL as determined by microplate BCA method |
| Purity | > 80% as determined by SDS-PAGE and Coomassie blue staining |
| Buffer | 25 mM Tris-HCl, 100 mM glycine, pH 7.3, 10% glycerol |
| Bioactivity | ELISA standard (PMID: 29250027) |
| Preparation | Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. |
| Note | For testing in cell culture applications, please filter before use. Note that you may experience some loss of protein during the filtration process. |
| Storage | Store at -80°C. |
| Stability | Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. |
| Shipping | Dry Ice |
| Reference Data | |
| RefSeq | NP_006167 |
| Locus ID | 4900 |
| UniProt ID | Q92686 |
| Cytogenetics | 11q24.2 |
| RefSeq Size | 1235 |
| RefSeq ORF | 234 |
| Synonyms | hng; RC3 |
| Summary | Neurogranin (NRGN) is the human homolog of the neuron-specific rat RC3/neurogranin gene. This gene encodes a postsynaptic protein kinase substrate that binds calmodulin in the absence of calcium. The NRGN gene contains four exons and three introns. The exons 1 and 2 encode the protein and exons 3 and 4 contain untranslated sequences. It is suggested that the NRGN is a direct target for thyroid hormone in human brain, and that control of expression of this gene could underlay many of the consequences of hypothyroidism on mental states during development as well as in adult subjects. provided by RefSeq, Jul 2008 |
| Protein Categories | Intracellular Proteins |
| Protein Families | Druggable Genome |
Reviews
Documents
| FAQs |
| SDS |
Resources
| Recombinant Protein Resources |
Other "Neurogranin" proteins (7)
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| PH301209 | NRGN MS Standard C13 and N15-labeled recombinant protein (NP_006167) | 10 ug |
$3,360.00
|
|
| PH324996 | NRGN MS Standard C13 and N15-labeled recombinant protein (NP_001119653) | 10 ug |
$3,360.00
|
|
| LC416815 | Lyophilized NRGN HEK293T cell transient overexpression lysate (as WB positive control) | 20 ug |
$206.00
|
|
| LC426667 | Lyophilized NRGN HEK293T cell transient overexpression lysate (as WB positive control) | 20 ug |
$206.00
|
|
| LY416815 | Transient overexpression lysate of neurogranin (protein kinase C substrate, RC3) (NRGN), transcript variant 1 (as WB positive control) | 100 ug |
$436.00
|
|
| LY426667 | Transient overexpression lysate of neurogranin (protein kinase C substrate, RC3) (NRGN), transcript variant 2 (as WB positive control) | 100 ug |
$436.00
|
|
| TP324996 | Recombinant protein of human neurogranin (protein kinase C substrate, RC3) (NRGN), transcript variant 2, 20 µg | 20 ug |
$867.00
|
|
Citations
The intact postsynaptic protein neurogranin is reduced in brain tissue from patients with familial and sporadic Alzheimer's disease
Kvartsberg, Lashley, Murray et al
Acta Neuropathol (2019) 137 (1), 89-102 DOI: 10.1007/s00401-018-1910-3
Kvartsberg, Lashley, Murray et al
Acta Neuropathol (2019) 137 (1), 89-102 DOI: 10.1007/s00401-018-1910-3
Cited by 107
AI Summary: OriGene products, specifically the anti-Neurogranin antibody (TA326016) and the Neurogranin cDNA clone (RC217445), were used in this study to detect and analyze neurogranin protein levels in human brain tissue samples, thereby enabling the investigation of neurogranin processing in Alzheimer's disease.
Alzheimer-associated cerebrospinal fluid fragments of neurogranin are generated by Calpain-1 and prolyl endopeptidase
Becker, Nazir, Brinkmalm et al
Mol Neurodegener (2018) 13 (1), 47 DOI: 10.1186/s13024-018-0279-z
Becker, Nazir, Brinkmalm et al
Mol Neurodegener (2018) 13 (1), 47 DOI: 10.1186/s13024-018-0279-z
AI Summary: OriGene's ORF clone RC201209 was used as the template for PCR amplification of human Neurogranin (Ng1-78) cDNA, enabling the production of recombinant Ng protein for enzymatic cleavage studies in this research.
Snippet: Human Ng1-78 cDNA was PCR-amplified using the ORF clone RC201209 from Origene as template and primers 5'ATGGACTGCTGCACCGAGAAC 3′ and 5´ CTAGTCTCCGCTGGGGCCGCCGCC 3′. Cloning into the pET_SUMO vector and protein;
Derivation of a Three Biomarker Panel to Improve Diagnosis in Patients with Mild Traumatic Brain Injury
Peacock, Van Meter, Mirshahi et al
Front Neurol (2017) 8, 641 DOI: 10.3389/fneur.2017.00641
Peacock, Van Meter, Mirshahi et al
Front Neurol (2017) 8, 641 DOI: 10.3389/fneur.2017.00641
AI Summary: OriGene’s recombinant full-length human NRGN and NSE proteins were used to generate standard curves for biomarker quantification in this study evaluating blood tests for mild traumatic brain injury.
Snippet: Recombinant full-length human NRGN and NSE proteins (Origene Technologies, Inc., Rockville, MD, USA) and recombinant full-length human MT3 (NovoPro Biosciences, Shanghai, China) were used to generate a standard curve relating analyte concentration to luminescent signal
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
