OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Cyp24a1 Mouse qPCR Primer Pair (NM_009996)

Be the first to review this product
SKU
MP203298
qSTAR qPCR primer pairs against Mus musculus gene Cyp24a1
  $150.00
3 Days*

Frequently Bought Together (3)

NP100055 A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
4 x 1.25 ml (500 rxns/20ul reaction)
$370.00
MR224484 Cyp24a1 (Myc-DDK-tagged) - Mouse cytochrome P450, family 24, subfamily a, polypeptide 1 (Cyp24a1), nuclear gene encoding mitochondrial protein
10 ug
$719.00
NP100042 First Strand cDNA Synthesis Kit (11801-100)
100 reactions
$540.00

Other products for "Cyp24a1 or BC109139"

Specifications
Specifications
Product Data
Locus ID 13081
Forward Sequence GCTCCTTCAAAAGGACACAGAGG
Reverse Sequence CGCTTGCCACACTTTGGTGTTG
ACCN BC109139, BC109140, NM_009996, NM_009996.1, NM_009996.2, NM_009996.3, NM_009996.4
UniProt ID Q64441
Synonyms 24-OH; 24-OHase; CP2; CP24; Cyp2; Cyp24
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Modeling vitamin D actions in triple negative/basal-like breast cancer
Laporta, Welsh
J. Steroid Biochem. Mol. Biol. (2013)
Cited by 72
AI Summary: OriGene contributed mouse-specific primers for Cyp24a1, Cib2, Enpp1, Prelp, Has2, Hbegf, Plau, and Postn, which were used for gene expression analysis by qPCR in this study modeling vitamin D actions in triple negative/basal-like breast cancer.
Snippet: cDNA preparations were independently analyzed in duplicate with mouse specific primers for Cyp24a1, Cib2, Enpp1, Prelp, Has2, Hbegf, Plau and Postn (Origene, Rockville, MD) using SYBR Green PCR Master Mix (ABgene, Thermo Scientific) on an ABI Prism 7900HT ... Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products