OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Osteocalcin (BGLAP) Human qPCR Primer Pair (NM_199173)

Be the first to review this product
SKU
HP226248
qSTAR qPCR primer pairs against Homo sapiens gene BGLAP
  $150.00
3 Days*

Frequently Bought Together (4)

TA321966 Anti-BGLAP Rabbit Polyclonal Antibody
100 ul
$305.00
NP100055 A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
4 x 1.25 ml (500 rxns/20ul reaction)
$370.00
RC220555 BGLAP (Myc-DDK-tagged)-Human bone gamma-carboxyglutamate (gla) protein (BGLAP)
10 ug
$150.00
NP100042 First Strand cDNA Synthesis Kit (11801-100)
100 reactions
$540.00

Other products for "BGLAP or NM_199173"

Specifications
Specifications
Product Data
Locus ID 632
Forward Sequence CGCTACCTGTATCAATGGCTGG
Reverse Sequence CTCCTGAAAGCCGATGTGGTCA
ACCN NM_199173, NM_199173.1, NM_199173.2, NM_199173.3, NM_199173.4, NM_199173.5, BC113432, BC113434, BU622466, NM_199173.6
UniProt ID P02818
Synonyms BGP; OC; OCN
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

MicroRNA-138 Inhibits Periodontal Progenitor Differentiation under Inflammatory Conditions
Zhou, Luan, Chen et al
J. Dent. Res. (2015)
Cited by 54
AI Summary: OriGene contributed gene-specific primer sets used for quantitative RT-PCR assays to measure mRNA levels of key genes (OC, Runx2, Col1, Col3, SGK3, IL6, and DefA4) in the study.
Snippet: The relative mRNA levels of OC, Runx2, Col1, Col3, SGK3, IL6, and DefA4 were examined using a quantitative 2-step reverse transcriptase polymerase chain reaction (RT-PCR) assay with gene-specific primer sets (OriGene, Rockville, MD, USA) as described previously ... Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products